1. Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan

2. Reverse genetics An approach used to determine the function of a gene from known DNA sequence

3. BLAST: Basic Local Alignment Search Tool

4. Gene project You are working on an Arabidopsis gene discovery project, and your job is to sequence cDNAs and then learn all you can about the genes from all types of databases: DNA sequence, genome, and publication databases. TCCTGCATTCAATGTGATCAATGGAGGCAGTCATGCTGGGAATAGTTT GGCTATGCAAGAGTTTATGATACTACCTGTAGGAGCTACCTCATTCTC GGAGGCCTTCCAGATGGGAAGTGAAGTTTATCATACATTGAAGGGGAT AATCAAAACTAAGTATGGTCAAGATGCTTGTAATGTCGGAGATGAAGG AGGGTTTG Query sequence:

5. NCBI homepage

6. 1. What is the name of the gene that the unknown cDNA sequence is derived from?

9. 2. Identify the location of this gene by Arabidopsis thaliana chromosome and genome locus.

11. 3.What is the function of this gene?

12. 4. How many nucleotides are in the coding sequence of this gene?

13. 1434 nucleotides

14. 5. What sequence of amino acids is encoded by your unknown cDNA sequence?

15. 6.In the Arabidopsis genome, what other gene has the most similar protein sequence to your gene?

18. 7. In the human genome, what is the most closely related gene to your Arabidopsis gene?

20. 8. What T-DNA insertion for this gene would be likely to knock out gene function?

24. 9.Give a literature citation to a research article that studied a knock out of this gene in Arabidopsis.