Presentation is loading. Please wait.

Presentation is loading. Please wait.

Protein Synthesis and Gene Mutation

Published byChristian Todd Modified over 8 years ago

Similar presentations

Presentation on theme: "Protein Synthesis and Gene Mutation"— Presentation transcript:

1 Protein Synthesis and Gene Mutation

2 Objectives 2. Discuss the relationships among chromosomes, genes, and DNA. 2.5 Describe the functions of mRNA, tRNA, amino acids, and ribosomes in protein synthesis. 2.6 Describe the causes and effects of both chromosome and gene mutations.

3 Protein Synthesis DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictate the order of amino acids that make up a protein

4 Protein Synthesis Protein synthesis occurs in two primary steps
mRNA (messenger RNA) copy of a gene is synthesized Cytoplasm of prokaryotes Nucleus of eukaryotes 1 2 mRNA is used by ribosome to build protein (Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein) Cytoplasm of prokaryotes and eukaryotes Some proteins feed directly into rough ER in eukaryotes

5 Protein Synthesis Transcription Initiation (eukaryotes)
RNA polymerase binds to a region on DNA known as the promoter, which signals the start of a gene Promoters are specific to genes RNA polymerase does not need a primer Transcription factors assemble at the promoter forming a transcription initiation complex – activator proteins help stabilize the complex Gene expression can be regulated (turned on/off or up/down) by controlling the amount of each transcription factor (eukaryotes)

6 Protein Synthesis Transcription Elongation
1) INITIATION Transcription Elongation RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) recall RNA uses uracil instead of thymine AGTCAT UCA GUA

7 Protein Synthesis Transcription Elongation
RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another. Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) recall RNA uses uracil instead of thymine RNA polymerase catalyzes bond to form between ribose of 3’ nucleotide of mRNA and phosphate of incoming RNA nucleotide 5’ 3’ + ATP 5’ 3’ + ADP

8 Protein Synthesis Transcription Elongation
The gene occurs on only one of the DNA strands; each strand possesses a separate set of genes

9 Protein Synthesis Transcription Termination
1) INITIATION Transcription Termination A region on DNA known as the terminator signals the stop of a gene RNA polymerase disengages the mRNA and the DNA

10 Protein Synthesis Alternative Splicing (eukaryotes only)
Exons are “coding” regions Introns are removed different combinations of exons form different mRNA resulting in multiple proteins from the same gene Humans have 30,000 genes but are capable of producing 100,000 proteins Alternative Splicing (eukaryotes only)

11 Protein Synthesis mRNA mRNA copy of a gene is synthesized
Transcription Translation mRNA tRNA synthesis mRNA copy of a gene is synthesized Cytoplasm of prokaryotes Nucleus of eukaryotes 1 2 mRNA mRNA is used by ribosome to build protein (Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein) Cytoplasm of prokaryotes and eukaryotes Some proteins feed directly into rough ER in eukaryotes

12 Protein Synthesis Translation
Transcription Translation mRNA tRNA synthesis Translation Every three mRNA nucleotides (codon) specify an amino acid

13 Protein Synthesis Translation
tRNA have an anticodon region that specifically binds to its codon

14 Protein Synthesis Translation Each tRNA carries a specific amino acid
Transcription Translation mRNA tRNA synthesis Translation Each tRNA carries a specific amino acid

15 Protein Synthesis Transcription Translation mRNA tRNA synthesis Aminoacyl tRNA synthetases attach amino acids to their specific tRNA

16 Protein Synthesis Translation Initiation
Transcription Translation mRNA tRNA synthesis Translation Initiation Start codon signals where the gene begins (at 5’ end of mRNA) 5’ 3’ AUGGACAUUGAACCG… start codon

17 Protein Synthesis Translation Initiation
Small ribosomal subunit Translation Initiation Start codon signals where the gene begins (at 5’ end of mRNA) Ribosome binding site (Shine Dalgarno sequence) upstream from the start codon binds to small ribosomal subunit then this complex recruits the large ribosomal subunit Small ribosomal subunit Ribosome Large ribosomal subunit

18 Protein Synthesis Translation Scanning
The ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct protein large ribosome subunit small ribosome subunit

19 Protein Synthesis Translation Scanning
The ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct protein

20 Protein Synthesis Translation Termination
Ribosome disengages from the mRNA when it encounters a stop codon

21 AGCUACCAUACGCACCCGAGUUCUUCAAGC
Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC

22 AGCUACCAUACGCACCCGAGUUCUUCAAGC
Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine

23 AGCUACCAUACGCACCCGAGUUCUUCAAGC
Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser

24 AGCUACCAUACGCACCCGAGUUCUUCAAGC
Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser S – Y –H– T – H – P – S – S – S - S

25 Protein Synthesis Translation Multiple RNA polymerases can engage a gene at one time Multiple ribosomes can engage a single mRNA at one time Transcription DNA mRNAs

26 Protein Synthesis Eukaryotes: transcription occurs in the nucleus and translation occurs in the cytoplasm Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm

27 RNA There are four main types of RNA:
mRNA - RNA copy of a gene used as a template for protein synthesis rRNA - part of structure of ribosomes tRNA - amino acid carrier that matches to mRNA codon snRNA - found in nucleus where they have several important jobs

Download ppt "Protein Synthesis and Gene Mutation"

Similar presentations

Chapter 10 How proteins are made.

Chapter 10 How proteins are made.
DNA Replication and RNA Production Selent. Replication The process of copying DNA The two chains of nucleotides separate by unwinding and act as templates.

DNA Replication and RNA Production Selent. Replication The process of copying DNA The two chains of nucleotides separate by unwinding and act as templates.
The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.
CH 11.4 & 11.5 “DNA to Polypeptide”.

CH 11.4 & 11.5 “DNA to Polypeptide”.
How Are Genes Expressed? Chapter11. DNA codes for proteins, many of which are enzymes. Proteins (enzymes) can be used to make all the other molecules.

How Are Genes Expressed? Chapter11. DNA codes for proteins, many of which are enzymes. Proteins (enzymes) can be used to make all the other molecules.
Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.

Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.
 Nucleic acid similar to DNA.  Made of sugar ribose.  Generally single stranded.  Instead of thymine, uses uracil (U)

 Nucleic acid similar to DNA.  Made of sugar ribose.  Generally single stranded.  Instead of thymine, uses uracil (U)
RNA = RiboNucleic Acid Synthesis: to build

RNA = RiboNucleic Acid Synthesis: to build
10-2: RNA and 10-3: Protein Synthesis

10-2: RNA and 10-3: Protein Synthesis
Transcription & Translation

Transcription & Translation
PROTEIN SYNTHESIS.

PROTEIN SYNTHESIS.
RNA (Ribonucleic acid)

RNA (Ribonucleic acid)
RNA Ribonucleic Acid.

RNA Ribonucleic Acid.
FROM GENE TO PROTEIN: TRANSCRIPTION & RNA PROCESSING Chapter 17.

FROM GENE TO PROTEIN: TRANSCRIPTION & RNA PROCESSING Chapter 17.
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.

Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
Transcription and Translation

Transcription and Translation
Protein Synthesis. DNA acts like an instruction manual“ – it provides all the information needed to function the actual work of translating the information.

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.
Gene Expression and Control

Gene Expression and Control
Protein Synthesis Transcription and Translation. The Central Dogma The information encoded with the DNA nucleotide sequence of a double helix is transferred.

Protein Synthesis Transcription and Translation. The Central Dogma The information encoded with the DNA nucleotide sequence of a double helix is transferred.
DNA RNA PROTEIN TRAIT Transcription & Translation Chapter 10.

DNA RNA PROTEIN TRAIT Transcription & Translation Chapter 10.

Similar presentations

Ads by Google