1. Chemistry and Biology of DNA in the Age of Personalized Medicines Dr. Ishtiaq Ahmad Khan Assistant Professor Dr. Panjwani Center for Molecular Medicine and Drug Research International Center for Chemical and Biological Sciences, University of Karachi.

2. DNA in every organism

3. DNA – The molecule of Life The building blocks of DNA are nucleotides. each nucleotide composed of: – a nitrogenous base (adenine, thymine, guanine, cytosine abbreviated as A, T, G, C) – a 5-carbon sugar called deoxyribose – a phosphate group (PO 4 )

5. Nucleotides Nitrogenous base (adenine) 5-carbon Ribose sugar Phosphate group ester linkage

6. DNA Structure Nucleotides are connected to each other by phosphodiester bonds to form a long chain

7. Double helical Structure of DNA – 2 sugar-phosphate backbones – nitrogenous bases toward the interior of the molecule – bases form hydrogen bonds with complementary bases on the opposite sugar-phosphate backbone A pairs with T (2 H bonds) C pairs with G (3 H Bonds)

9. Noble Prizes in DNA Chemistry Watson, Crick, and WilkinsWatson, Crick, and Wilkins (1962): Discovery of structure of DNA H. Gobind Khorana (1973) Chemical synthesis of oligonucleotide Berg, Gilbert, and SangerBerg, Gilbert, and Sanger (1980): The determination of base sequences in nucleic acids Mullis and SmithMullis and Smith (1993): Contributions to the developments of methods within DNA-based chemistry. Invention of PCR

10. Sequencing the DNA In the 1970’s, Sanger’s group discovered a method of 'reading' the linear DNA sequence using special nucleotide bases called chain terminators or di-deoxy nucleotides. This method is still in use today. Died on November 19, 2013 Frederick Sanger

11. Dideoxy Nucleotide

22. Next Generation DNA Sequencing Complete genome copies Massively parallel sequencing, Shotgun Genome Sequencing: for sequencing the whole genome and whole exome

23. Fragmented genome chunks NOT REALLY DONE BY DUCK HUNTERS ! Hydroshearing, sonication, enzymatic shearing NOT REALLY DONE BY DUCK HUNTERS ! Hydroshearing, sonication, enzymatic shearing Next Generation DNA Sequencing

24. Major NGS Platforms 454 FLX Genome Sequencer (Roche) Pyrosequencing method Hiseq2000, Solexa Genome Analyzer (Illumina) Sequencing by seynthesis SOLiD ( Applied Biosystems) Sequencing by ligation chemistry Ion-torrent (Life technologies) An integrated semiconductor device enabling non-optical genome sequencing Heliscope (Heliscope Biosciences) Single molecule sequencing by synthesis 24

25. ATTGTTCCCACAGAC CG CGGCGAAGCATTGT TCC ACCGTGTTTTCCGA CCG TTTCCGACCGAAATG GC TTGTTCCCACAGACC GTG AGCTCGATGCCGGCG AAG ATGCCGGCGAAGCAT TGT TAATGCGACCTCGATG CC ACAGACCGTGTTTCC CGA AAGCATTGTTCCCAC AG TGTTTTCCGACCGAA AT CCGACCGAAATGGC TCC TGCCGGCGAAGCCT TGT Assembly of short reads 17 bp 66 bp TAATGCGACCTCGATGCCGGCGAAGCATTGTTCCCACAGACCGTGTTTTCCGACCGAAATGGCTC C Consensus sequence:

26. Overview of DNA to RNA to Protein A gene is expressed in two steps – Transcription: RNA synthesis – Translation: Protein synthesis

27. DNA: A long double-stranded string of nucleotides that encode for many genes. Gene The Central Dogma: DNA  RNA  Protein

28. DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. RNA The Central Dogma: DNA  RNA  Protein

29. DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. The Central Dogma: DNA  RNA  Protein RNA Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons.

30. DNA: A long double-stranded string of nucleotides that encode for many genes. Gene Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. RNA: A single-stranded copy of one gene. The Central Dogma: DNA  RNA  Protein Codon 1

31. DNA: A long double-stranded string of nucleotides that encode for many genes. Gene Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. RNA: A single-stranded copy of one gene. The Central Dogma: DNA  RNA  Protein Codon 1 Codon 2

32. DNA: A long double-stranded string of nucleotides that encode for many genes. Gene Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. Amino acid 1 Amino acid 2 RNA: A single-stranded copy of one gene. The Central Dogma: DNA  RNA  Protein Codon 1 Codon 2

33. DNA: A long double-stranded string of nucleotides that encode for many genes. Gene Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. Amino acid 1 Amino acid 2 Protein! RNA: A single-stranded copy of one gene. The Central Dogma: DNA  RNA  Protein Codon 1 Codon 2

34. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCTDNA:

35. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCT Met DNA: Amino Acids/Protein:

36. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCT Met DNA: Amino Acids/Protein: Val

37. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCT MetLeu DNA: Amino Acids/Protein: Val

38. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCT MetLeuSer DNA: Amino Acids/Protein: Val

39. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCT MetLeuSerPro DNA: Amino Acids/Protein: Val

40. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCT MetLeuSerPro DNA: Amino Acids/Protein: Val

41. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCT MetLeuSerPro DNA: Amino Acids/Protein: Val ATG GTG CTG TCT ACTDNA:

42. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCT MetLeuSerPro DNA: Amino Acids/Protein: Val ATG GTG CTG TCT ACT MetLeuSerThr DNA: Amino Acids/Protein: Val

43. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCT MetLeuSerPro DNA: Amino Acids/Protein: Val Words: Tom and Sam are bad ATG GTG CTG TCT ACT MetLeuSerThr DNA: Amino Acids/Protein: Val

44. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCT MetLeuSerPro DNA: Amino Acids/Protein: Val Words: Tom and Sam are bad ATG GTG CTG TCT ACT MetLeuSerThr DNA: Amino Acids/Protein: Val Tom and Sam are sad Words:

45. A small change in the gene sequence can result in a very different protein ATG GTG CTG TCT CCT MetLeuSerPro DNA: Amino Acids/Protein: Val Words: Tom and Sam are bad ATG GTG CTG TCT ACT MetLeuSerThr DNA: Amino Acids/Protein: Val Tom and Sam are sad Words: Changes in DNA are called variations or mutations Variations in the DNA (genotype) can cause observable changes (phenotype) in individuals

46. Human Genome Research Human Genome Project in 2003 Finishing the euchromatic sequence of the human genome. Nature 2004; 431 (7011): 931-945. Phase I HapMap project in 2005 A haplotype map of the human genome. Nature 2005: 437(7063):1299-1320 Encyclopedia of DNA Elements (ENCODE) project in 2007 Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 2007; 447(7146):799-816 1000 Genomes Project in 2008 DNA sequences. A plan to capture human diversity in 1000 genomes. Science 2008; 319(5863):395

47. Genotypes and Human Disease Do all humans have the same DNA? Single nucleotide polymorphisms or SNPs. We can associate SNPs with medical histories of individuals and achieve statistically significant correlations. Pharmacogenetics (PGx) is the science of how an individual’s genotype affects their body’s response to drugs.

48. Variations in our DNA make us UNIQUE!

49. Genomics in Drug Discovery

50. Personalized Medicines Personalized medicine is the use of information from a patient's genotype to: Initiate a preventative measure against the development of a disease or condition, or Select the most appropriate therapy for a disease or condition that is particularly suited to that patient.

51. Why does it matter? In treating all people with a certain lung cancer without having a genetic test, 10 % of people might respond. In treating people who have a genetic test and are found to have a tumour mutation, 85% of people treated for that mutation might respond. The best drug for a specific disease in a particular person.

52. Is Personalized medicine only for sick people? Definitely not. Because an individual's genome influences his or her likelihood of developing (or not developing) a broad range of medical conditions, personalized medicine focuses strongly on wellness and disease prevention. If a person's genomic information indicates a higher-than- average risk of developing diabetes or a particular form of cancer, that person may choose a lifestyle, or sometimes be prescribed medications.

53. Examples of SNPs Linked to Drug Response

54. Case Study: Warfarin Most widely prescribed oral anticoagulant for preventing thrombolytic events, despite its narrow therapeutic range. Problematic dosing due to patient’s diet, age, and other medications. CYP2D9/VKORC1 genes analysis predicts its prescription. (Mol Interv. 2006, 6(4): 223-277)

55. Case Study: Irinotecan Irinotecan is used as chemotherapeutic agent for the treatment of metastatic colorectal cancer. It produces adverse drug reactions in some patients. genotyping assay is carried out to mutations in UGT1A1 gene for irinotecan prescribing. (Personalized Medicine 2006, 3(4): 415-419)

56. Case Study: Abacavir Abacavir is a nucleoside analog reverse transcriptase inhibitor used to treat human immunodeficiency virus (HIV). Its main side effect is hypersensitivity reaction (HSR). HSR is associated with ethnicity. A significantly increased risk of abacavir-induced HSR in human leukocyte antigen (HLA)- B*57:01-carrying patients. Sci China Life Sci. 2013, 56(2):119-24

57. Interferon Therapy Standard approved therapy for Hepatitis C Differential response Interleukin 28B gene (IL28B) variants which are associated with decreased HCV clearance Interleukin 28B gene (IL28B) variants are considered as key players in deferential therapeutic responses.

58. Malignant Melanoma 2007

59. Melanoma 2013 Targeting treatment to a specific variant in the Melanoma gene.

60. Structure of Vemurafenib (marketed as Zelboraf)

61. Beta-thalassemias (β-thalassemias) are a group of inherited blood disorders caused by problems in the production of hemoglobin, the oxygen-carrying protein in red blood cells. Cause is the mutations in beta-chain, 200 SNPs and several deletion 61

62. 62 Hummmm……

63. Genomics at International Center for Chemical and Biological

68. Current Research Projects Five human genome project Integrated analysis of HCV genome and Exome of Hepatitis C patients to Study genetics of differential response to interferon therapy Assessment of genetic factors for Ventricular Septal Defect Genomics of Diabetic patients

74. 74

75. Memorable Moments

79. Red Fort (Lal Qila) Delhi India

80. Education complex of Islamic era at Qutab complex Delhi

81. Qutab Minar Delhi India