Presentation is loading. Please wait.

Presentation is loading. Please wait.

Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used.

Published byAustin Hudson Modified over 8 years ago

Similar presentations

Presentation on theme: "Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used."— Presentation transcript:

1 Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? The Need for Protein Making Instructions Phenotype = genotype (+ environment) 1 chromosome gene ---> 1 protein DNA-->RNA (copy)-->protein production Structure of DNA, The Genetic Material Two polynucleotide strands with H bonds DNA + protein make up a chromosome RNA is single stranded, difft sugar, uracil How DNA copies itself when a cell divides DNA replication by unzipping DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices Transcription: Making a short DNA copy RNA polymerase makes RNA from DNA Only one set of instructions (gene) is copied Copy is complementary to the DNA gene In eukaryotes, the RNA copy is edited The Three Kinds of RNA mRNA: carries instructions for 1 protein rRNA: structural support in ribosomes tRNA: amino acid trucks with anticodons Steps of Translation (Protein Synthesis) DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

2 Flow of Genetic Information
Figure 8.2

3 DNA is a Double-Stranded Chain of Nucleotides

4 DNA Figure 8.4

5 Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? The Need for Protein Making Instructions Phenotype = genotype (+ environment) 1 chromosome gene ---> 1 protein DNA-->RNA (copy)-->protein production Structure of DNA, The Genetic Material Two polynucleotide strands with H bonds DNA + protein make up a chromosome RNA is single stranded, difft sugar, uracil How DNA copies itself when a cell divides DNA replication by unzipping DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices Transcription: Making a short DNA copy RNA polymerase makes RNA from DNA Only one set of instructions (gene) is copied Copy is complementary to the DNA gene In eukaryotes, the RNA copy is edited The Three Kinds of RNA mRNA: carries instructions for 1 protein rRNA: structural support in ribosomes tRNA: amino acid trucks with anticodons DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

6 DNA Replication is Semiconservative
Figure 8.3

7 DNA DNA replication is semiconservative Figure 8.7

8 DNA Replication Involves Several Enzymes
Figure 8.6

9 DNA Genes are Instructions for Making Specific Polypeptides
Central Dogma of Biology: How Shape and Form Are Dictated By DNA Genes DNA Genes are Instructions for Making Specific Polypeptides Genotype: The genes carried in a cell for a particular trait A segment of DNA (gene) carries specific coded instructions for the making of a single proteins. Phenotype: The physical expression of genes for a particular trait

10 Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? The Need for Protein Making Instructions Phenotype = genotype (+ environment) 1 chromosome gene ---> 1 protein DNA-->RNA (copy)-->protein production Structure of DNA, The Genetic Material Two polynucleotide strands with H bonds DNA + protein make up a chromosome RNA is single stranded, difft sugar, uracil How DNA copies itself when a cell divides DNA replication by unzipping DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices Transcription: Making a short DNA copy RNA polymerase makes RNA from DNA Only one set of instructions (gene) is copied Copy is complementary to the DNA gene In eukaryotes, the RNA copy is edited The Three Kinds of RNA mRNA: carries instructions for 1 protein rRNA: structural support in ribosomes tRNA: amino acid trucks with anticodons DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

11 Transcription is Performed by RNA Polymerase

12 Translation or Protein Synthesis
Figure 8.2

13 Anatomy of a Messenger RNA
mRNA is a Chain of Nucleotides Trailer Leader Figure 10.17

14 Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? The Need for Protein Making Instructions Phenotype = genotype (+ environment) 1 chromosome gene ---> 1 protein DNA-->RNA (copy)-->protein production Structure of DNA, The Genetic Material Two polynucleotide strands with H bonds DNA + protein make up a chromosome RNA is single stranded, difft sugar, uracil How DNA copies itself when a cell divides DNA replication by unzipping DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices Transcription: Making a short DNA copy RNA polymerase makes RNA from DNA Only one set of instructions (gene) is copied Copy is complementary to the DNA gene In eukaryotes, the RNA copy is edited The Three Kinds of RNA mRNA: carries instructions for 1 protein rRNA: structural support in ribosomes tRNA: amino acid trucks with anticodons DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

15 3 Types of RNA – Each With a Different Job
Messenger RNA (mRNA) Carries copy of gene information to the ribosome to make protein anticodon Transfer RNA (tRNA) = CUG C U G Carries amino acids to the ribosome for linking; identified by anticodon “sign” Part of the structure of the ribosome; key component in amino acid linking machinery Ribosomal RNA (rRNA)

16 How Gene Instructions are Communicated

17 mRNA Codon Dictionary of the Genetic Code

18 CGTTTACGACCGGCCTTAGATCCTGACG
Central Dogma: DNARNAProtein DNA template strand: CGTTTACGACCGGCCTTAGATCCTGACG Transcription by RNA polymerase mRNA: GCAAAUGCUGGCCGGAAUCUAGGACUGC Translation by ribosome Protein: Met - Leu - Ala - Gly - Ile

19 Translation in Prokaryotes Can Occur Simultaneously With Transcription
Figure 8.11 19

20 A Ribosome Has Two Subunits and Three tRNA Binding Sites

21 Translation: Initiation, Elongation, Termination
Elongation (3-4 steps) Termination 21

22 Steps of Translation Protein Synthesis Movie

Download ppt "Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used."

Similar presentations

2.7 DNA Replication, transcription and translation

2.7 DNA Replication, transcription and translation
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.

What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
PROTEIN SYNTHESIS.

PROTEIN SYNTHESIS.
8.4 DNA Transcription 8.5 Translation

8.4 DNA Transcription 8.5 Translation
12-3: RNA AND PROTEIN SYNTHESIS Biology 2. DNA double helix structure explains how DNA can be copied, but not how genes work GENES: sequence of DNA that.

12-3: RNA AND PROTEIN SYNTHESIS Biology 2. DNA double helix structure explains how DNA can be copied, but not how genes work GENES: sequence of DNA that.
How Genes Work. Transcription The information contained in DNA is stored in blocks called genes  the genes code for proteins  the proteins determine.

How Genes Work. Transcription The information contained in DNA is stored in blocks called genes  the genes code for proteins  the proteins determine.
RNA carries DNA’s instructions.

RNA carries DNA’s instructions.
The Structure and Function of DNA CHAPTER 10 Transcription (DNA  RNA) RNA Polymerase Processing of Eukaryotic RNA Translation (mRNA  Protein) The Three.

The Structure and Function of DNA CHAPTER 10 Transcription (DNA  RNA) RNA Polymerase Processing of Eukaryotic RNA Translation (mRNA  Protein) The Three.
Transcription and Translation

Transcription and Translation
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis
Central Dogma DNA  RNA  Protein. …..Which leads to  Traits.

Central Dogma DNA  RNA  Protein. …..Which leads to  Traits.
RNA and Protein Synthesis

RNA and Protein Synthesis
12-3 RNA and Protein Synthesis

12-3 RNA and Protein Synthesis
Peptide Bond Formation Walk the Dogma RECALL: The 4 types of organic molecules… CARBOHYDRATES LIPIDS PROTEINS (amino acid chains) NUCLEIC ACIDS (DNA.

Peptide Bond Formation Walk the Dogma RECALL: The 4 types of organic molecules… CARBOHYDRATES LIPIDS PROTEINS (amino acid chains) NUCLEIC ACIDS (DNA.
RNA AND PROTEIN SYNTHESIS

RNA AND PROTEIN SYNTHESIS
Protein Synthesis: Protein Synthesis: Translation and Transcription EQ: What is the Central Dogma and what processes does it involve? Describe processes.

Protein Synthesis: Protein Synthesis: Translation and Transcription EQ: What is the Central Dogma and what processes does it involve? Describe processes.
8.2 Structure of DNA KEY CONCEPT DNA structure is the same in all organisms.

8.2 Structure of DNA KEY CONCEPT DNA structure is the same in all organisms.
The student is expected to: 4B investigate and explain cellular processes, including homeostasis, energy conversions, transport of molecules, and synthesis.

The student is expected to: 4B investigate and explain cellular processes, including homeostasis, energy conversions, transport of molecules, and synthesis.
RNA, Transcription, Translation

RNA, Transcription, Translation

Similar presentations

Ads by Google