1. Recombinant DNA & Biotechnology

2. Recombinant DNA recombinant DNA molecules contain DNA from different organisms –any two DNAs are joined by DNA ligase 5’GGATCATGTA-OH P-CCCGATTTCAAT 3’CCTAGTACAT-P HO-GGGCTAAAGTTA 5’GGATCATGTACCCGATTTCAAT 3’CCTAGTACATGGGCTAAAGTTA DNA ligase

3. figure 17-01.jpg restriction enzymes degrade invading viral DNA Figure 16.1

4. Cleaving and Rejoining DNA RE produce many different DNA fragments

5. restriction enzymes recognize specific DNA sequences (recognition sites) 5’GGATCGAATTCCCGATTTCAAT 3’CCTAGCTTAAGGGCTAAAGTTA EcoRI a palindrome reads the same left-to-right in the top strand and right-to-left in the bottom strand

6. staggered cuts produce “sticky ends” Figure 16.4

7. Cutting and Rejoining DNA restriction enzymes (RE) produce specific DNA fragments for ligation –RE are defensive weapons against viruses –RE “cut” (hydrolyze) DNA at specific sites –RE “staggered cuts” produce “sticky ends” –sticky ends make ligation more efficient

8. gel electrophoresis Figure 16.2

9. Cleaving and Rejoining DNA RE produce many different DNA fragments –for a 6 bp recognition site 1/4 6 = 1/4096 x 3x10 9 bp/genome = 7.3 x10 5 different DNA fragments gel electrophoresis sorts DNA fragments by size hybridization with a labeled probe locates specific DNA fragments

10. Southern hybridization of a labeled probe to a DNA target Figure 16.3

11. gel electrophoresis & Southern hybridization

12. Cloning Genes genetic engineering requires lots of DNA –cloning produces lots of exact copies –DNA clones are replicated by host cells –DNA is cloned in a DNA vector –a DNA vector has an origin of replication (ori) that the host cell recognizes

13. pBR322 is a historical bacterial cloning plasmid a Yeast Artificial Chromosome vector has yeast ori, centromere and telomeres Agrobacterium Ti plasmid has an Agrobacterium ori and T DNA that integrates into plant DNA Figure 16.5

14. Cloning Genes a DNA vector with its ligated insert must be introduced into the host cell chemical treatment makes cells “competent” - ready for heat shock transformation electroporation opens pores in the plasma membrane mechanical treatment inserts DNA physically

15. Cloning Genes vectors carry reporter genes –antibiotic resistance protects host cells that carry a vector (selection) –proteins such as  -galactosidase, luciferase or Green Fluorescent Protein (GFP) identify transformed cells (screening)

16. bacterial plasmid pBR322 is a cloning vector that encodes ampicillin & tetracycline antibiotic resistances insertion of a target DNA inactivates tetracycline resistance Figure 16.6

17. ligating vector to insert + each cut with the same RE DNA ligase ~4300 bp; 0.1 µg; 1.7 x 10 11 molecules 900 bp; 0.063 µg; 5.7 x 10 10 molecules

18. ligation/transformation ligation of vector to insert produces several products –vector ligated to itself (recircularized) –insert ligated to itself (circularized, no ori) –two vectors ligated together –two (or more) inserts ligated together –several DNAs ligated together, but not circularized –1 vector ligated to 1 insert DNA

19. ligation/transformation transformation is a very inefficient process 1µg typical plasmid vector = 3 x 10 11 copies added to highly competent E. coli cells yields at best 10 9 antibiotic resistant colonies 3 x 10 11 /10 9 = 300 vectors/transformed E. coli

20. ligation/transformation ligation produces a mess of products transformation is an inefficient random process selection (antibiotic) sorts out successful vector transformations screening identifies transformants with the insert in the vector

21. 37 form colonies 8.5 x 10 7 cells are plated 24 contain vectors with inserts

22. bacterial transformation has several potential outcomes Figure 16.6

23. creation of a DNA library in host bacteria using a plasmid vector Figure 16.7

24. Sources of DNA for Cloning chromosomal DNA restriction fragments –ligated to vectors cut with the same RE –transferred into bacteria = a genomic DNA library a target DNA is identified by hybridization

25. reverse transcription produces DNA from an RNA template Figure 16.8

26. Sources of Genes for Cloning mRNAs reverse transcribed into cDNAs –tissue-specific; age specific; treatment vs. normal, etc. cDNAs –ligated to vectors –grown in host cells and screened by hybridization

27. Sources of Genes for Cloning make DNA sequences synthetically –custom oligonucleotides duplicate natural sequences or create mutant sequences site-directed mutagenesis makes an exact change (mutation) in a cloned gene

28. What to do With a Cloned (Altered?) Gene compare gene expression in two cell types –a “gene chip” (microarray) displays short synthetic oligonucleotides –mRNAs from two different sources are labeled differently –mRNAs bind to their complements –a scanner detects mRNA binding by one cell type, the other, or both

29. microarray analysis compares gene expression in two different samples Figure 16.10

30. What to do With a Cloned (Altered?) Gene mutational analysis –classical genetics found mutations and studied their effects –cloning technology causes mutations and studies their effects “knockout” mutations

31. insertion of an inactivated gene by homologous recombination Figure 16.9

32. What to do With a Cloned (Altered?) Gene RNA interference (RNAi) produces a “knockdown” phenotype –a gene transcribed “backwards” makes an antisense transcript antisense transcript + normal mRNA = double-stranded RNA –small interfering RNA (siRNA) forms double-stranded RNA with normal mRNA –some viruses inject double-stranded RNA

33. What to do With a Cloned (Altered?) Gene eukaryotic cells attack d.s. RNA –enzymes “cut” d.s. RNA into 21-23 nt siRNAs (“dicer”) –siRNAs guide enzymes to cut target RNAs (“slicer”) –siRNAs guide RNA dependent RNA polymerase to make more d.s. RNA –[miRNAs control developmental gene expression]

34. siRNA is used to silence gene expression Figure 16.11

35. What to do With a Cloned (Altered?) Gene search for “invisible” interactions –two hybrid systems identify a receptor’s ligand split a transcription activator into DNA- binding and activating domains fuse receptor to DNA-binding domain fuse cDNA library to activating domain activate a reporter gene when receptor and ligand bind

36. a two-hybrid system detects binding proteins Figure 16.12

37. What to do With a Cloned (Altered?) Gene make the protein… –a cloning vector tells the cell to replicate it (with an ori) –an expression vector tells a cell to efficiently transcribe and translate a gene in it

38. an expression vector instructs a host cell to make a protein Figure 16.13

39. tissue plasminogen activator is a clot buster Figure 16.14

40. Table 16.1

41. What to do With a Cloned (Altered?) Gene medically useful proteins have been expressed plant biotechnology speeds up crop improvement –endogenous insecticides –herbicide resistance –improved nutrition –stress tolerance “biotech” animals serve as bioreactors to produce useful proteins

42. “somatic cell nuclear transfer” with engineered cells makes a sheep that produces a useful protein

43. CSI Short Tandem Repeats (STRs) are used to identify individuals by “DNA Fingerprinting” –many sets of STRs exist in the human genome –the lengths of STR markers differs for different individuals –different-sized STR markers run differently on agarose gels

44. DNA fingerprint analysis using an STR marker Figure 16.17

45. Figure 16.18