1. Approaches to Assessing Unintended Health Effects of Genetically Engineered Foods

2. Understanding the Science Behind the Approach Ann L. Yaktine, Ph.D. Institute of Medicine The National Academies

3. The USDA, FDA, and EPA asked the National Academies to convene a committee of experts to: Outline science-based approaches for assessing or predicting unintended health effects of genetically engineered foods, and Outline science-based approaches for assessing or predicting unintended health effects of genetically engineered foods, and Compare the potential for unintended effects of GE foods with those derived from conventional and other methods of genetic modification. Compare the potential for unintended effects of GE foods with those derived from conventional and other methods of genetic modification.

4. Safety of Genetically Engineered Foods: Approaches to Assessing Unintended Effects

5. The Task to the Study Panel Focus on mechanisms by which unintended changes in composition of food occur as a result of various breeding and propagation methods Focus on mechanisms by which unintended changes in composition of food occur as a result of various breeding and propagation methods Assess the extent to which these mechanisms are likely to lead to significant compositional changes in food Assess the extent to which these mechanisms are likely to lead to significant compositional changes in food

6. Assess methods to detect unintended changes in food in order to determine potential human health effects Assess methods to detect unintended changes in food in order to determine potential human health effects Identify appropriate scientific questions and methods for determining unintended changes in food from GE organisms Identify appropriate scientific questions and methods for determining unintended changes in food from GE organisms Outline methods to assess the potential short- and long-term human consequences of such changes Outline methods to assess the potential short- and long-term human consequences of such changes

7. The study focused on scientific approaches and methodology used to predict and assess unintended effects.

8. Defining the Science

9. What is Genetic Engineering? One type of genetic modification that involves an intended targeted change in a gene sequence to achieve a specific result through the use of recombinant DNA (rDNA) technology.

10. rDNA Techniques Microbial Vectors Microbial Vectors

11. Electroporation

12. Microinjection

13. Transposable Elements TCGATAGCGCAAAACTAAATGCCAAGCA TCAA ATGCCAAGCA

14. Genetic engineering is targeted, that is, the gene sequence is specific and the insertion site is known. ATGCCAAGCA CATATTCTC TCGATAGCGCAAAACTAA

15. Non-GE Techniques of Genetic Modification Mutation Breeding: Mutation Breeding: Radiation Mutagenesis Radiation Mutagenesis Chemical Mutagenesis Chemical Mutagenesis

16. Induced mutagenesis causes random changes in the DNA sequence. ATGCCAACATATTCTCAGCGCAAAACTAATCGAGCA

17. Other Non-GE Techniques of Genetic Modification Simple Selection Simple Selection Crossing Crossing Interspecies Crossing Interspecies Crossing

18. The progeny of cross-breeding cannot always be predicted.

19. Targeted, Non-Targeted, and Conventional Methods of Genetic Modification All Have the Potential to Produce Unintended Effects.

20. Genetic Engineering (Targeted Genetic Modification) Genetic Engineering (Targeted Genetic Modification) Impact of expressing proteins from an unrelated species? Impact of expressing proteins from an unrelated species? Brazil nut gene into soybean Brazil nut gene into soybean Effects of new proteins operating through unexpected pathways? Effects of new proteins operating through unexpected pathways?

21. Non-targeted Genetic Modification Non-targeted Genetic Modification Cannot predict outcome due to random changes to the gene sequence Cannot predict outcome due to random changes to the gene sequence Conventional Crossing Conventional Crossing Expression pattern of new traits cannot always be predicted Expression pattern of new traits cannot always be predicted Lenape potato Lenape potato

22. Mechanisms of genetic engineering overlap with those of other types of genetic modification. Mechanisms of genetic engineering overlap with those of other types of genetic modification. Techniques used to alter the genetic composition of an organism are mechanistically different. Techniques used to alter the genetic composition of an organism are mechanistically different. Why is predicting an unintended effect difficult?

23. It is unlikely that all methods of either genetic engineering or conventional breeding will have equal probability for unintended effects.

24. It is more likely that the product of the modification rather than the process itself will produce an unintended effect.

25. What Scientific Approaches Can Be Used to Identify Compositional Changes in Food that May Lead to an Unintended Effect? Targeted Quantitative Analysis Targeted Quantitative Analysis Profiling (Untargeted) Analysis Profiling (Untargeted) Analysis

26. Targeted Analysis Predefined Compounds Predefined Compounds Amino acids Amino acids Lipids Lipids Vitamins Vitamins Other nutrients, toxicants, allergens Other nutrients, toxicants, allergens Isolated for Analysis Isolated for Analysis Quantified Quantified

27. Profiling Analysis Multiple Compounds in a Sample Multiple Compounds in a Sample Compounds Identified and Quantified: Compounds Identified and Quantified: Electrophoretic separation Electrophoretic separation Spectrometry Spectrometry Genomic, proteomic, etc. Genomic, proteomic, etc.

28. Profiling: Genomics and Proteomics Genomic technology can measure the level of thousands of transcripts simultaneously Genomic technology can measure the level of thousands of transcripts simultaneously Proteomic analysis detects and quantifies individual or groups of proteins Proteomic analysis detects and quantifies individual or groups of proteins

29. Toxicity Testing Agronomic Comparisons Agronomic Comparisons Feeding Trials Feeding Trials

30. Application, Validation, and Limitations of Tools for Identifying and Predicting Unintended Effects

31. Any adverse health effect from unintended compositional changes will be a consequence of: The inherent toxicity of the compound The inherent toxicity of the compound Allergens Allergens Toxins/toxicants Toxins/toxicants Anti-nutrients Anti-nutrients The level of dietary exposure The level of dietary exposure Exposure to high-level consumers Exposure to high-level consumers Food habits related to culture Food habits related to culture Effect of food preparation/processing Effect of food preparation/processing

32. Agronomic Comparison Agronominc traits are evaluated in the laboratory, greenhouse, and field APPLICATION Varieties with unusual features are discarded Varieties with unusual features are discardedLIMITATION Not sufficient for identifying all unintended changes Not sufficient for identifying all unintended changes

33. Feeding Trials Test Animals are Fed Modified Whole Foods or Food Extracts APPLICATION Compares nutritional quality of GE crop with its conventional counterpart Compares nutritional quality of GE crop with its conventional counterpartLIMITATIONS Nutrient requirements of animal models Nutrient requirements of animal models Volume of food that can be administered Volume of food that can be administered Limited test dosage and exposure time Limited test dosage and exposure time

34. Food is a Complex Mixture The use of targeted and non-targeted (profiling) methods to assess the safety of genetically modified foods is increasing, however, there are limitations to our ability to interpret and utilize the information generated.

35. The complexity of food composition challenges the ability of modern analytical chemistry and bioinformatics to identify compositional changes and determine their biological relevance.

36. Looking to the Future

37. Although the array of analytical and epidemiological techniques has increased, gaps remain in our ability to: Identify compositional changes that result from genetic modification Identify compositional changes that result from genetic modification Determine the biological relevance of such changes to human health Determine the biological relevance of such changes to human health Devise appropriate scientific methods to predict and assess unintended effects Devise appropriate scientific methods to predict and assess unintended effects

38. Recommendations from the Study Develop and employ: Standardized Sampling Methodologies Standardized Sampling Methodologies Validation Procedures Validation Procedures Performance-based Techniques for Targeted Analysis and Profiling Performance-based Techniques for Targeted Analysis and Profiling Integrated Database of Food Composition from Industrial and Regulatory Agency Sources Integrated Database of Food Composition from Industrial and Regulatory Agency Sources

39. Standardized Sampling Methodologies Should include: Comparison of modified foods to unmodified varieties developed under a variety of environmental conditions Comparison of modified foods to unmodified varieties developed under a variety of environmental conditions Comparison of modified foods to commonly consumed commercial varieties Comparison of modified foods to commonly consumed commercial varieties

40. Validation Procedures The tracking potential of all genetically modified foods should be improved, including: Pre-market to post-market feedback loop Pre-market to post-market feedback loop Dietary survey tools Dietary survey tools

41. Performance-Based Techniques for Targeted Analysis and Profiling Scientific methods to detect unintended compositional changes must be continually scrutinized for accuracy, validity, and application Scientific methods to detect unintended compositional changes must be continually scrutinized for accuracy, validity, and application Current databases of novel and naturally- occurring compounds must be improved and expanded Current databases of novel and naturally- occurring compounds must be improved and expanded

42. Acknowledgements The Institute of Medicine and the Division of Earth and Life Sciences, The National Academies The Committee to Identify and Assess Unintended Effects of GE Foods on Human Health, Dr. Bettie Sue Masters, Chair