1. ABE: Advances in Bioscience Education Dr. Kabi Neupane, Coordinator (co-PI, LCC) Faculty Partners John Berestecky (KCC) Ingelia White (WCC) Priscilla Millen (LCC) Janice Ito (LCC) Catherine Unabia (HPU) David Christopher (PI, UH, Manoa) Bringing together students and faculty to explore research in the molecular and cellular biosciences.

2. Summer 06

3. Stepping into scientific research What are our goals? What kind of research are we doing ? What is an Arabidopsis plant? Research philosophy.  From the classroom to the lab bench with intensity.

4. Reach for new learning and knowledge. Goals Take risk, try something new, unfamiliar and break thru the fear barrier. To learn and grow - actively, by doing….to change. Move out of the comfort zone and into the stretch zone.

5. Willing to sail into unchartered waters To discover… To discover… make mistakes… make mistakes… …change direction. …change direction. Research = Stretch Zone

6. Have FAITH that you can learn from mistakes as you move along. Scientific Research: Learn by Trial and error. Embrace mistakes

7. Persistance is more important than strength

8. Scientific Research: Discover new knowledge. Use tools of molecular and cellular biology to figure out the underlying biochemical to figure out the underlying biochemical processes that control how living cells work. processes that control how living cells work.

9. Plant growth… How do leaves, roots, stems, flowers develop from common precursor cells? How can native and crop plants safely resist pests and diseases that kill them ? RESEARCH QUESTIONS: How can plants be protected from environmental stress: drought, flood, salt, heat, UV, pollution ?

10. “Arabidopsis thaliana: Research on a lawn mower to understand a corvette”

11. Research Philosophy to gain insight into complex systems Learn the inner workings of something complicated, then start by studying the simpler version. $ 2,000 $ 65,0000 Model System - essence of an automobile

12. Complex fascinating plants adapt to diverse environments

13. simple Arabidopsis thaliana Plants Complex

14. Cornfield Arabidopsis “field” in 4 inch petri plate Economy of Size

15. Corn  100 - 140 days to seed Arabidopsis  30-40 days to seed Economy of Time

16. Corn Arabidopsis Economy of Genes, Genome and DNA Arabidopsis has smallest genome, vascular plants  48,000 genes  10 chromosomes  ~ 5 billion nucleotides  Much junk spacer DNA  29,000 genes  5 chromosomes  125 million nucleotides  small spacer DNA AGTCAGTC

17. Arabidopsis = encapsulates the essence of all plants in a small package  First fully sequenced genome of any plant  All genes mapped and isolated  Catalogue of genes can be ordered via mail  Knockouts of genes  MUTATE THEM  Study the activity of 1000’s of genes simultaneously  Easy to genetically engineer

18.  Used as a starting point to identify genes in other plants  Arabidopsis has facilitated the genetics of all plants  Answer the question: What do the genes do? All of the genes in Arabidopsis have been found in other plants.

19. Amazing fact !  60% genes in plants have counterparts in human DNA  Genes for …Basic cellular processes  Energy production, ATP  Cell division  Enzymes  Protein biosynthesis

20. GGTTCCAAAAGTTTATTGGATG CCGTTTCAGTACATTTATCGTTT GCTTTGGATGCCCTAATTAAAA GTGACCCTTTCAAACTGAAATT CATGATACACCAATGGATATCC TTAGTCGATAAAATTTGCGAGT ACTTTCAAAGCCAAATGAAATT ATCTATGGTAGACAAAACATTG ACCAATTTCATATCGATCCTCC TGAATTTATTGGCGTTAGACAC AGTTGGTATATTTCAAGTGACA AGGACAATTACTTGGACCGTA ATAGATTTTTTGAGGCTCAGCA AAAAAGAAAATGGAAATACGA GATTAATAATGTCATTAATAAAT CAATTAATTTTGAAGTGCCATT GTTTTAGTGTTATTGATACGCTA ATGCTTATAAAAGAAGCATGGA GTTACAACCTGACAATTGGCT GTACTTCCAATGAGCTAGTACA AGACCAATTATCACTGTTTGAT GTTATGTCAAGTGAACTAATGA ACCATAAACTTGGTCA From DNA sequence (chemical) to Life

21. - Recombinant DNA technology - Biochemistry - Microscopy - Molecular genetics - Computers Tools of molecular and cellular biology Use these tools from an actual research project

22. Complicated name: Complicated name: What does it mean? What does it mean? National Sciences Foundation (NSF) funds ABE: “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks”

23. “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks”

24. Functional Genomics: New field of biological scienceNew field of biological science Rooted in GeneticsRooted in Genetics Genome: all of the genes encoded in DNA in a living organism.Genome: all of the genes encoded in DNA in a living organism. Function: Research to figure out what the genes are doing.Function: Research to figure out what the genes are doing. What proteins do they encode and what jobs in the cell are they responsible for?What proteins do they encode and what jobs in the cell are they responsible for?

25. What jobs do proteins do in a cell? 1. Structure: hold things up1. Structure: hold things up 2. Enzymes: activity make and burn energy.2. Enzymes: activity make and burn energy. Stimulate growth and biomass production. Stimulate growth and biomass production. 1000’s different enzymes -> unique activities1000’s different enzymes -> unique activities Figure out their activities.Figure out their activities. ENZ ENZ A -----------> B Where the enzyme is located in the cell?Where the enzyme is located in the cell? Do they need other protein partners to do their job?Do they need other protein partners to do their job?

26. “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks”

27. DNA RNA PROTEIN||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Transcribed Transcribed Translated Translated  Making of a protein: Converting the code in a polymer of nucleic acid to a polymer of amino acid

28. ENZYME: Protein Disulfide Isomerase = PDI Chain of amino acids representing a PDI. Disulfide: “Two sulfurs” The amino acid containing sulfur is cysteine Bond with 2 cysteines | SH | SH | SH

29. ENZYME: Protein Disulfide Isomerase Isomer: Different molecules with same chemical formula. Alter chemical bonding --> different “shapes” --> activities and functions. Isomerase: an enzyme that can make different molecular shapes out of the same substance. Disulfide Isomerase: emzyme that alters molecular shape by acting on the disulfide bonds.

30. PDI can make different protein shapes based on altered disulfide bonding 2 isomers with new activity ! | SH | SH | SH -S- S- | SH -S S- | SH OR

31. “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks

32. Proteins do not do their job unless they are folded correctly So, PDIs fold other proteins correctly in cells. A major responsibility for keeping cells normal, development, metabolism and growth.

33. Protein Disulfide Isomerase (PDI) Gene Family Study all the PDIs in the genome of a small plant. All the PDIs in the same related family. but they go off and have different jobs at various locations in the cell.

34. PDI Protein folding- oxidoreductase PDI = cys Inactive state Active state All proteins have to fold to proper states

35. Oxidation Remove 2 electrons and 2 H+ 2 cysteine sulfhydryls --> make disulfide bridge Reduction --> breaks bridge --> –Add 2 electrons and 2 H+ to the 2 sulfhydryls Chemical Mechanism REDOX

36. But what about plants???? In Yeast and humans - PDIs located in the endoplasmic reticulum (ER)

37. Arabidopsis thaliana Plants

38. Primary structure of a generic PDI Signal sequence Directs a protein to a specific location Thioredoxin domains Contains 2 cysteines and active catalytic site for oxidation-reduction and folding of proteins ER retention motif KDELC--C

39. Research activities of workshop Learn some recombinant DNA methods Map genes that have been tagged by a T-DNA Learn PCR and RT-PCR Isolate proteins from leaves and detect proteins using antibodies Use a microscope to find where PDIs and green fluorescent protein are located in the cell.

40. What kind of results might you expect?

41. Any kind of result is a success Learn by doing !!! Have fun while you learn ! Nothing has to work perfectly to be a valuable learning experience.