1. Veterinary drugs Specificity: Legal substances Large usage Need Treatment and prevention Usage in different species

2. Veterinary drugs: endectocides Environment 80% of parental compound is excreted in feces Efficacy Target: parasites Meat Fat Milk Food security

3. Pharmacology Drug Drug Absorption Absorption Distribution Distribution Metabolisme Metabolisme Elimination Elimination Toxicity Toxicity Efficacy Efficacy Pharmacokinetic Pharmacodynamy

4. Many complex mecanisms 3 main famillies of actors act in synergy Pharmacokinetics Fate of drugs in the host organism

5. Exemple of a hepatic cell Phase I Cytochromes Metabolisation X-OH Transferases Transfer of gluthation Glucuronide, sulfone Phase II X-Glu X Xenobiotic Transporters Efflux Phase III MRP X-GluX X Pgp

6. 3 main actors Cytochromes Phase I Cytochromes Phase I Transférase Phase II Transférase Phase II Efflux ABC transporters Phase III Efflux ABC transporters Phase III

7. 2- Mechanisms of transmembrane transport of drugs – Examples Paracellular diffusion Paracellular diffusion oions, mannitol, polymers Passive diffusion across lipid bilayer Passive diffusion across lipid bilayer ofluoroquinolones, tetracycline (hydrophobic) Diffusion through OM channels and porins Diffusion through OM channels and porins -lactams, tetracyclins (hydrophilic, charged)-lactams, tetracyclins (hydrophilic, charged) Facilitated diffusion Facilitated diffusion oimipenem, catechols, albomycin, albicin Active Transport Active Transport oaminoglycosides, cycloserine, phosphomycin, alaphosphin Vesicle Trafficking Mediated Transport Vesicle Trafficking Mediated Transport opolymers, peptide hormones, targeted delivery

8. Active transporters Multiplicity Multiplicity Rates > passive Rates > passive Non-symmetrical (k in k out at [S i ] = [S o ]) Non-symmetrical (k in k out at [S i ] = [S o ]) Saturable transport - Michaelis-Menten Saturable transport - Michaelis-Menten Inhibitable- competitive, non-competitive Inhibitable- competitive, non-competitive Regulated- inducibility & repression Regulated- inducibility & repression Tissue specific- differential expression Energy dependent- active transport Tissue specific- differential expression Energy dependent- active transport primary pumps - respiration, photosyn, ATPaseprimary pumps - respiration, photosyn, ATPase secondary transporters (coupled to H +, Na + etc.)secondary transporters (coupled to H +, Na + etc.)

9. Active efflux ABC-transporters ATP-Binding Cassette transporters : ATP dependant transport Active efflux of a large amount of substrates: ions, steroïdes, phospholipids, conjugated molecules, peptides…..drugs… Nucleotide-binding-domains: ATPase activity Trans-membrane domaines

10. ABCA (13) ABCB =MDR (11) ABCC = MRP (13) ABCG (5) ABCA1ABCB1/MDR1 ABCC1 = MRP1 ABCG = ABC8 ABCA2 ABCB2 = TAP1 (RE) ABCC2 = MRP2 ABCG = BCRP ABCA3 ABCB2 = TAP1 (RE) ABCC3 = MRP3 ABCG4 ABCA4 ABCB4 = MDR2-3 ABCC4 = MRP4 ABCG5 ABCA5ABCB5 ABCC5 = MRP5 ABCG8 ABCA6ABCB6 ABCC6 = MRP6 ABCA7 ABCB7 (lysosomes) ABCC7 = CFTR ABCA8ABCB8 ABCC8 = SUR1 ABCA9ABCB9 ABCC9 = SUR2 ABCA10 ABCB11 = BSEP ABCC10 ABCA12ABCC11 ABCA13ABCC12 lipids/cholesterolDrugs/steroïdes/ biliary salts Conjuguated/anionsnucleotidesSterols/lipids/drugs Human ATP-Binding Cassette Transporters ABC MDR : multidrug resistant

11. Multidrog resistance transporters P-gp, MRPs, BCRP ATP-Binding cassette familly: ABC transporters Mediate the active efflux of xenobiotics Large specificity of substrates Involved in multidrug resistance Ubiquitus localisation ApicalABCG2 4 Apical 5 Basolatéral ABCC4, 5 MRP 4, 5 2 Apical 1, 3 Basolatéral ABCC1,2, 3 Multidrug rresistant protein MRP1,2,3 ApicalABCB1 P-glycoprotéineP-gp Localisation cellulaire Structure secondaire Gène Protéine Breast cancer resistant protein BCRP ou MXR

12. Substrates of P-glycoproteine Doxorubicine Anthracyclines Daunorubicine Epirubicine Alcaloïdes de la vinca Vincristine Vinblastine Epipodophyllotoxines Etoposide Teniposide TaxanesPaclitaxel Docetaxel Colchicine Actinomycine D Agents cytotoxiquesEmétine Topotecan Mithramycine Mitomycine Ritonavir Inhibiteurs des protéasesIndinavir Saquinavir Rhodamine 123 Hoechst 33342 ColorantsFura-2 AM Acridine 99mTc-SESTAMIBI Calcéine-AM Aldosterone StéroidesDexamethasone Progesterone Corticosterone Gramicidine D Valinomycine N-Acetyl-leucyl-leucyl-norleucine NAc-Leu-Leu-norLeu-al Peptides cyclique et linéaireNAc-Leu-Leu-Met-al Leupeptin Pepstatine A Facteur A Cyclosporine A Valspodar (PSC 833) Verapamil Bloqueur des canaux calciquesNifedipine Azidopine Dexniguldipine Quinidine Bépridil Réserpine AutresMorphine Bromocriptine Forskoline Ivermectine

13. Substrates of MRPs ou cMOAT (canalicular multispecific organic anion transporter) glutathione disulfide glutathione disulfide leukotrienes (C4, D4, E4, N-acetyl-E4) leukotrienes (C4, D4, E4, N-acetyl-E4) glutathione conjugates (e.g., DNP, bromosulfophthalein, metals Sb, As, Bi, Cd, Cu, Ag, Zn) glutathione conjugates (e.g., DNP, bromosulfophthalein, metals Sb, As, Bi, Cd, Cu, Ag, Zn) glucuronide conjugates (bilirubin, T3, p-nitrophenol, grepafloxacin) glucuronide conjugates (bilirubin, T3, p-nitrophenol, grepafloxacin) bile acid conjugates (glucuronides and sulfates) bile acid conjugates (glucuronides and sulfates) organic anions (folates, methotrexate, ampicillin, ceftiaxone, cefadozime, grepafloxacin, prevastatin, temocaprilate) organic anions (folates, methotrexate, ampicillin, ceftiaxone, cefadozime, grepafloxacin, prevastatin, temocaprilate)

14. P-glycoprotein and multidrug resistance (MDR) Gene of Pgp: MDR1 in humans and mdr1a/1b in rodents Gene of Pgp: MDR1 in humans and mdr1a/1b in rodents Phenotype of multidrug resistance (MDR) Phenotype of multidrug resistance (MDR) in tumor cells in tumor cells

15. Protection against xenobiotics Overexpression in cancer cells Localisation on main epithelial barriers Brain liver Intestine Testis Kidney Placenta …….

16. Cellular localisation Distribution between apical and basolateral pole

17. At cellular level Lower intracellular bioavailability of xenobiotic (drugs) Lower toxicity Lower drug efficacy In the whole animal Physiological compounds: excretion of metabolites or toxins Xenobiotics: Lower intestinal absorption Increase intestinal and biliary elimination Reduces disposable fraction of the drugs Protects the central nervous system Summary: role of P-gp

18. Models Cells, vesicles Whole animal Parasites ATP ADP Methodology ATP NH 2 COOH 1 12 ATP In Out Substrate Inhibitor ATPase Tools to study MDR transporters Protein expression

19. Drug Interactions & Drug Transport Cinical assays in humans Digoxin - non-metabolized substrate for PgP Digoxin - non-metabolized substrate for PgP Verapamil, amiodarone, and quinidine increase plasma levels, reduce renal and non-renal clearance, increase blood/brain barrier transport. Dose adjustment may be needed in 50% of cases.Verapamil, amiodarone, and quinidine increase plasma levels, reduce renal and non-renal clearance, increase blood/brain barrier transport. Dose adjustment may be needed in 50% of cases. St. John's wort (Hypericum perforatum) decreased digoxin AUC by 25% after 10 days treatment through induction of PgP.St. John's wort (Hypericum perforatum) decreased digoxin AUC by 25% after 10 days treatment through induction of PgP. HIV Protease Inhibitors HIV Protease Inhibitors Amprenavir clearance reduced by nelfinavir (-41%) and by indinavir (-54%), but not saquinavir.Amprenavir clearance reduced by nelfinavir (-41%) and by indinavir (-54%), but not saquinavir. FDA warning against Hypericum supplementsFDA warning against Hypericum supplements

20. Drug Resistance & Reversal MDR1 (P-glycoprotein) – drug efflux pump MDR1 (P-glycoprotein) – drug efflux pump Multiple trials of multiple agents – recent efforts at inhibiting transcriptionMultiple trials of multiple agents – recent efforts at inhibiting transcription Steady state digoxin therapy was established in normal healthy volunteers (1 mg then 0.125 mg/day). Initiation of valspodar (400 mg followed by 200 mg twice per day) caused immediate and progressive increases in digoxin AUC (+211%) and decreases in total body, renal, and non-renal clearance (-67%, - 73%, -58%) after 5 days.Steady state digoxin therapy was established in normal healthy volunteers (1 mg then 0.125 mg/day). Initiation of valspodar (400 mg followed by 200 mg twice per day) caused immediate and progressive increases in digoxin AUC (+211%) and decreases in total body, renal, and non-renal clearance (-67%, - 73%, -58%) after 5 days. BCRP (breast cancer resistance protein or ABCG2) BCRP (breast cancer resistance protein or ABCG2) Inhibited by fungal toxin fumitremorgin C, but neurotoxic side effectsInhibited by fungal toxin fumitremorgin C, but neurotoxic side effects Kol143 and other derived analogs developed inhibit BCRP, but not PgP or MRPKol143 and other derived analogs developed inhibit BCRP, but not PgP or MRP Non-toxic in mice, increased oral availability of topotecan in miceNon-toxic in mice, increased oral availability of topotecan in mice RFC (reduced folate carrier) - antifolate drugs (methotrexate) RFC (reduced folate carrier) - antifolate drugs (methotrexate) Resistant leukemia cell lines were selected by stepwise dosesResistant leukemia cell lines were selected by stepwise doses Cross resistance (>2000x) to five novel hydrophilic antifolates shownCross resistance (>2000x) to five novel hydrophilic antifolates shown Intracellular folate levels reduced, increased requirement 42xIntracellular folate levels reduced, increased requirement 42x Hypersensitive to hydrophobic antifolatesHypersensitive to hydrophobic antifolates Mutations clustered in exons 2 and 3, TMD1Mutations clustered in exons 2 and 3, TMD1

21. Exemple of veterinary drugs Macrocyclic lactones: potent parasiticides

22. Lactones macrocycliques: Massive utilisation versus optimized utilisation 1/3 of veterinary drugs are parasiticides anti-parasitaires (among them 60% are macrocyclic lactones ) High efficacy with large spectrum: endectoparasiticide

23. Endectocidal Macrocyclic Lactones Large use of MLs Prevention and therapy = Necessity Emergence of resistant parasites We must give existing active compounds the best chance to work

24. 22132 Ivermectin X = -CH 2 --CH- R = CH(CH)CHCH 3 1a323 Abamectin B X = -CH=CH- R 1 = CH(CH)CHCH Doramectin X = -CH=CH- R 1 = Cyclohexyl Eprinomectin B 1a X = -CH=CH- R 1 = CH(CH 3 )CH 2 CH 3 R 2 = NHCOCH 3 Moxidectin a. Généralités et Structure I. Macrocyclic lactones (MLs) 23 22 13 4 25 AVERMECTIN MILBEMYCIN O O OH O O H O H O H H N O

25. Plasma Intestine Biliairy elimination Biotransformation Intestinal secretion Storage Liver Entero-hepatic cycle Adipose tissue Efficacy Route administration Molecule Species Pathophysiology Feces Milk Toxicity Brain Pharmacokinetics of MLs Low liver biotransformation High P-glycoprotein interaction

26. P-gp and Ivermectin Brain Intestine Overall bioavailability Parasite Ivermectin ATP NH 2 COOH 1 1212 ATP In Ivermectin Out

27. Pgp and ivermectin neurotoxicity Natural model Colley CF-1 Artificial model Brain Ivermectin 0.2 mg/kg Alteration of Pgp function Ivm sensitivity of colley dogs SYMPTOMS: Ataxia Tremors Mydriasis Coma Neurotoxicity Murray -Grey ? Mdr1ab -/-

28. Genetic disorder in Ivm sensitive Colley Beagle of reference tgctggtttttggaaacatgacag - - - - ctttgcaaatgcaggaatttcaagaaacaaaacttttccagttataattaatgaa Ivm Sensitive male tgctggtttttggaaacatgacag - - - - ctttgcaaatgcaggaatttcaagaaacaaaacttttccagttataattaatgaa Ivm sensitive female tgctggtttttggaaacatgacagatagctttgcaaatgcaggaatttcaagaaacaaaacttttccagttataattaatgaa Beagle of reference Lack of protein in tissues Colley sensitive Beagle Premature Stop Codon (Roulet et al 2003) P-gp Synthesis of a truncated protein of 78 aa Deletion of 4 base pairs on P-gp gene (exon 2) DIINESFANAGISRNKTFPV Stop ALQMQEFQETKLFQL N N M M T T Sensitive Colley - - - - - - - - - …… Colley Deletion Western Blot Intestine

29. Small Intestine Bile Dose (µg/kg) 0 1 2 3 4 5 100 200 400 Ivermectin (µg/kg BW) 29 Laffont et al. 2002 Ratio intestine / bile = 5 Intestinal excretion of ivermectin In situ model Intestinal closed loop Ivermectin (ng / cm / kg) 0 10 20 30 40 50 duodenum jejunum ileum ** Control Verapamil Involvement of ABC transporters

30. Pharmacokinetics of ivermectin P-gp deficient mice mdr1ab-/- Ivermectin concentration in plasma (ng/ml)

31. Verapamil in rat (Alvinerie et al, 1999) Verapamil in rat (Alvinerie et al, 1999) Quercetin in sheep (Dupuy et al. 2003) Quercetin in sheep (Dupuy et al. 2003) Loperamide in sheep (Lifschitz et al. 2004) Loperamide in sheep (Lifschitz et al. 2004) Verapamil in sheep ( Molento et al, 2004) Verapamil in sheep ( Molento et al, 2004) Itraconazole and valspodar in rat (Ballent et al, 2006) Itraconazole and valspodar in rat (Ballent et al, 2006) Ketoconazole in dog (Alvinerie, unpublished data) Ketoconazole in dog (Alvinerie, unpublished data) In vivo P-gp reversing agents Impact on bioavailability of MLs

32. Ivermectin concentration (ng/g) Ketoconazole and ivermectin Ivermectin concentration in dog plasma

33. La P-gp module lexposition et Efficacité thérapeutique des LMs Médicament Hôte Parasite Parasite Résistance A bsorption Parasite SNC toxicité Efficacité D istribution Transporteurs ABC BHM Transport lipoprotéines Eimination Dose administrée Transporteurs ABC Tissu adipeux