1. Human Genetics
(Chapter 3: and some of 4)

2. The structure of DNA
Composed of 4 nucleotide bases, 5 carbon sugar and phosphate.
Base pair = rungs of a ladder.
Edges = sugar-phosphate backbone.
Double Helix
Anti-Parallel

3. The structure of DNA
Figure 2.21

4. DNA Replication Figure 2.22a
Remember – the two strands run in opposite directions
Synthesis of a new (daughter) strand occurs in the opposite direction of the old (parental) strand.
Complementary base-pairing occurs
A with T and G with C
G and C have three hydrogen bonds
A and T have two hydrogen bonds

5. DNA Replication
Each new double helix is composed of an old (parental) strand and a new (daughter) strand.
As each strand acts as a template, process is called Semi-conservative Replication.
Replication errors can occur. Cell has repair enzymes that usually fix problem. An error that persists is a mutation.
This is permanent, and alters the phenotype.

6. The structure of RNA
Formed from 4 nucleotides, 5 carbon sugar, phosphate.
Uracil is used in RNA.
It replaces Thymine
The 5 carbon sugar has an extra oxygen.
RNA is single stranded.

7. Central Dogma of Molecular Biology
DNA holds the code
DNA makes RNA
RNA makes Protein
DNA to DNA is called REPLICATION
DNA to RNA is called TRANSCRIPTION
RNA to Protein is called TRANSLATION

8. Central Dogma of Molecular Biology
There are exceptions:
Retroviruses
Use RNA as the genetic code
Must make DNA before making protein product
This new DNA makes RNA and then a protein
Also, one protein is not always the product of a single gene – we will talk about this later in the course!

9. Transcription – DNA to RNA
Figure 3.3 (1)
(RNA polymerase)

10. Transcription – DNA to RNA
Figure 3.3 (2)

11. Transcription – DNA to RNA
Figure 3.3 (3)

12. Transcription – DNA to RNA
Figure 3.3 (4)

13. A close-up view of transcription
RNA nucleotides
RNA
polymerase
Newly made
RNA
Direction of
transcription
Template
strand of DNA

14. How does the order or sequence of nucleotides in a DNA and then a RNA molecule determine the order of amino acids in a protein? (Translation)
TACCTGAACGTACGTTGCATGACT
DNA
RNA
AUGGACUUGCAUCGAACGUACUGA
Met-Asp-Leu-His-Arg-Thr-Tyr-STOP
protein

15. Translation Translation requires: Amino acids (AAs)
Transfer RNA: (tRNA) Appropriate to its time, transfers AAs to ribosomes. The AA’s join in cytoplasm to form proteins. 20 types. Loop structure
Ribosomal RNA: (rRNA) Joins with proteins made in cytoplasm to form the subunits of ribosomes. Linear molecule.
Messenger RNA: (mRNA) Carries genetic material from DNA to ribosomes in cytoplasm. Linear molecule.

16. Translation
The mRNA has a specific “open reading frame” made up of three base pairs –codon.
The tRNA has the complementary base-pairing fit to the codon –known as an Anticodon
Each of these codes for an amino acid

17. Translation Initiation— Elongation—
mRNA binds to smaller of ribosome subunits, then, small subunit binds to big subunit.
AUG start codon--complex assembles
Elongation—
add AAs one at a time to form chain.
Incoming tRNA receives AA’s from outgoing tRNA. Ribosome moves to allow this to continue
Termintion— Stop codon--complex falls apart

18. Translation
Figure 3.5 (1)

19. Translation
Figure 3.5 (2)

20. Translation
Figure 3.5 (3)

22. What happens when it all goes wrong?
MUTATIONS!!!!!!!!!!
two general categories
1.result in changes in the amino acids in proteins
A change in the genetic code
2.Change the reading frame of the genetic message
Insertions or deletions

23. Mutations
Figure 3.6a

24. Mutations

25. Remember Thalidomide?
The structure of thalidomide is similar to that of the DNA purine bases adenine (A) and guanine (G).
In solution, thalidomide binds more readily to guanine than to adenine, and has almost no affinity for the other nucleotides, cytosine (C) and thymine (T).
Furthermore, thalidomide can intercalate into DNA, presumably at G-rich sites.

26. Remember Thalidomide?
Thalidomide or one of its metabolites intercalates into these G-rich promoter regions, inhibiting the production of proteins and blocking development of the limb buds.
This intercalation would not significantly affect the over 90 per cent of genes that rely primarily on guanine sequences.
Most other developing tissues in the embryo rely on pathways without guanine, and are therefore not affected by thalidomide

27. Remember Thalidomide?

28. Genes can lead to inherited diseases
A gene which doesn’t function on an autosomal chromosome can lead to devastating diseases
Autosomal chromosomes are 22 pairs of chromosomes which do not determine gender
Such diseases can be caused by both a dominant or a recessive trait

29. Autosomal Recessive Disorders
Tay-Sachs Disease:
Jewish people in USA (E. Euro descent)
Not apparent at birth
4 to 8 months
Neurological impairment evident
Gradually becomes blind and helpless
Develops uncontrollable seizures/paralyzed
Allele is on Chromosome 15
Lack of enzyme hexosaminidase A (Hex A)
Lysosomes don’t work, build up in brain

30. Autosomal Recessive Disorders
Cystic Fibrosis
Most common in USA (Caucasian)
1 in 20 caucasians is a carrier
Mucus in bronchial and pancreas thick/viscous
Breathing and food digestion problems
Allele is on chromosome 7
Cl ions can not pass through plasma membrane channels
Cl ions pass –water goes with it. No water, thick mucus

32. Autosomal Recessive Disorders
Phenylketonuria (PKU)
Affects in in 5,000 newborns
Most common nervous system disorder
Allele is on chromosome 12
Lack the enzyme needed for the metabolism of the amino acid phenylalanine
A build up of abnormal breakdown pathway
Phenylketone
Accumulates in urine. If diet is not checked, can lead to severe mental retardation

33. Autosomal Dominant Disorders
Neurofibromatosis
Very common genetic disorder
Tan spots on skin
Later tumors develop
some sufferers have large head and ear and eye tumors.
Allele is on chromosome 17
Gene controls the production of a protein called neurofibromin
This naturally stops cell growth

34. Autosomal Dominant Disorders
Huntington Disease
Leads to degeneration of brain cells
Severe muscle spasms and personality disorders
Attacks in middle age
Allele is on chromosome 4
Gene controls the production of a protein called huntington
Too much AA glutamine. Changes size and shape of neurons

36. Incomplete Dominant traits
Sickle Cell Anemia
Controlled by intermediate phenotypes at a ratio of 1:2:1
Red blood cells are not concave
Normal Hemoglobin (HbA). Sickle cell (HbS)
HbA-HbA-normal Hbs-Hbs – sickle cell
HbA-Hbs- have the trait

37. Sickle-cell hemoglobin
Mutations
- any change in the nucleotide sequence of DNA
Normal hemoglobin DNA
Mutant hemoglobin DNA
mRNA
mRNA
Normal hemoglobin
Sickle-cell hemoglobin
Glu
Val
Figure 10.21

38. Sickle Cell Anemia

39. Individual homozygous for sickle-cell allele
Sickle-cell (abnormal) hemoglobin
Abnormal hemoglobin crystallizes,
causing red blood cells to become sickle-shaped
Sickled cells
Clumping of cells
and clogging of
small blood vessels
Breakdown of
red blood cells
Accumulation of
sickled cells in spleen
Physical
weakness
Heart
failure
Pain and
fever
Brain
damage
Damage to
other organs
Spleen
damage
Anemia
Impaired
mental
function
Pneumonia
and other
infections
Kidney
failure
Paralysis
Rheumatism
Figure 9.21

40. Genetic engineering

41. Genetic engineering The direct alteration of a genotype
Human genes can be inserted into human cells for therapeutic purposes
Genes can be moved from one species to another
Moving genes from human to human or between species requires the use of special enzymes known as restriction enzymes.
These cut DNA at very specific sites
They restrict DNA from another species – isolated from bacteria.

42. Genetic engineering Figure 4.1
Each restriction enzyme cuts the DNA at a specific site, defined by the DNA sequence
Enzymes which produce “sticky ends” are more useful
Allows gene of interest to be inserted into a vector
Also need a DNA probe
Radioactive ssDNA that will bind to gene of interest so you can locate it

43. Genetic engineering Transferred DNA is denatured to give ssDNA
The probe will bind to gene of interest by Complementary base-pairing - A with T and G with C

44. Genetically engineered insulin
Figure 4.3 (1)

45. Genetically engineered insulin
Figure 4.3 (2)

46. Genetically engineered insulin
Figure 4.3 (3)

47. Genetically engineered insulin
Figure 4.3 (4)

48. Genetically engineered insulin
Why do some people not like the idea?
The plasmid also needs a “marker gene”
This is usually an antibiotic resistance gene
Some people fear that the insulin which is
extracted from the bacteria would also
contain a gene product to make anyone who
uses the insulin resistant to antibiotics!

49. Gene therapy Can treat human diseases
eg – severe combined immune deficiency syndrome (SCIDS)
Bubble- Boy/Girl syndrome
The enzyme which causes this is on chromosome 20
Called adenosine deaminase (ADA)
Many problems
Difficult to transfer large genes
Insert in a way that the gene expresses to protein correctly
TRANSLATION!!!!!!!!!!!!

50. Gene therapy
Figure 4.4 (1)

51. Gene therapy
Figure 4.4 (2)

52. Gene therapy
Figure 4.4 (3)

53. Gene therapy
Figure 4.4 (4)

54. Gene therapy Figure 4.4 (5) Virus has genetic defect to
prevent viral reproduction
and spreading to other cells

55. Gene therapy
Figure 4.4 (6)
Virus vector must get the gene into the nucleus of the patient’s lymphocyte

56. Gene therapy
Figure 4.4 (7)
Gene has to be incorporated into cell’s DNA where it will be transcribed
Also inserted gene must not break up some other necessary gene sequence

57. Gene therapy
The genetically engineered lymphocytes injected into the patient should out grow the “natural” (defective) lymphocytes
As ADA-deficient cells to not divide as fact as those with the active enzyme
Not permanent - need repeat injections as injected lymphocytes are mature and have limited life span
Stem cells would get around this problem (later!)

59. Genetic Profiling We could screen everyone’s DNA for mutations.
How would this affect insurance?
How would this affect health care?
What about “reproductive control”?
What do you think?

60. The end!
Any questions?