1. Genetics Notes

2. Just a little review before we get into the new stuff… The 6 characteristics all organisms share: –Have at least one cell –Can grow & develop –Have genetic material –Can reproduce –Have a metabolism –Can adapt & evolve

3. Two types of genetic material DNA (deoxyribonucleic acid) –Holds the information for making all the traits in an organism –Found in the nucleus, mitochondria, and chloroplasts –Double stranded molecule –Has 4 nucleotide bases A (adenine) T (thymine) C (cytosine) G (guanine) RNA (ribonucleic acid) –Carries the information from the DNA to the ribosomes –Found in the ribosomes and traveling between nucleus and ribosomes –Single stranded molecule –Has 4 nucleotide bases A (adenine) U (uracil) C (cytosine) G (guanine)

4. Nucleotide Bases A nucleotide base is a molecule that makes up DNA and RNA –Kind of like the letters of the alphabet make up our words Organisms from all 6 kingdoms have the same nucleotide bases in their RNA and DNA –All DNA and RNA (no matter what organism it comes from) is all built and works the exact same way –This is why we are able to take DNA from one organism and put it into other organisms and make it work The only thing that makes DNA different in different organisms is the order of the nucleotide bases The nucleotide bases from one strand of DNA always pair with a certain nucleotide base on the other strand (see next slide) –They also always pair with a certain nucleotide base on the RNA This is how a DNA strand creates an RNA strand to send the information for making a trait out to the ribosomes

5. Base pairing rules DNA to DNA rules –A pairs with T –T pairs with A –G pairs with C –C pairs with G DNA to RNA rules –A pairs with U –T pairs with A –G pairs with C –C pairs with G DNA Strand 1 A T A C G A T C G A T C G A C C C T DNA Strand 2 DNA Strand A T A C G A T C G A T C G A C C C T RNA Strand

6. Codons Once the DNA strand has created the RNA strand, the ribosomes will read the RNA strand 3 nucleotide bases at a time –A codon is a sequence of 3 nucleotide bases Each codon stands for a specific amino acid –Amino acids are the building blocks of proteins –Ribosomes read the RNA one codon at a time and hook together the amino acids to make proteins DNA Strand G T CA A TT C CG T GG C CA C T RNA Strand

7. Codon Rules The first nucleotide base in the RNA codon is in the innermost circle The second nucleotide base in the RNA codon is in the second ring outward The third (last) nucleotide base in the RNA codon is in the third ring outward The amino acid made by that RNA codon is in the outermost ring DNA Strand C A GT G CA A GC T TA G CC C A RNA Strand Amino Acids

8. Proteins A protein is a chain of amino acids Proteins are used for creating many traits like: –Speeding up metabolism reactions –Building body parts, like muscles –Coloring the skin, hair and eyes –Causing the release of other chemicals Proteins will begin with the amino acid MET and end with STOP The DNA sequence that creates the RNA that creates the protein is called a gene –Genes begin with a codon that codes for MET and end with a STOP codon –In between genes are sequences called introns that do not create proteins or traits DNA Strand C G GG T AT A CA A AA T GG A CC T GA C TT T T RNA Strand G C CC A UA U GU U UU A CC U GG A CU G AA A A Amino Acids

9. Types of Genes Dominant genes are sequences of DNA that code for a working version of a protein –Examples of human traits caused by dominant genes: Tongue rolling Cleft chin Achondroplasia (type of dwarfism) Recessive genes are sequences of DNA that code for a non-working version of a protein –Examples of human traits caused by recessive genes: Non-tongue rolling Smooth chin Normal height For each trait there may be many different versions an organism could have –The different versions of the genes that cause different versions of a trait to appear are called alleles

10. Special Cases The number of different versions that exist for a trait can tell you a little about the number of genes that create it –In general, the more versions of a trait there are, the more genes are responsible for creating it (less versions mean fewer genes) In many cases, there is 1 dominant gene and 1 recessive gene –This is true for a lot of traits that only have 2 versions In some cases there is more than 1 dominant version of a gene –Blood type is an example of this In some cases there is no real dominant version of a gene –Curly, wavy, and straight hair is an example of this In some cases the protein made by 1 gene combines with the proteins made by other genes to change what they do –Height is an example of this In some cases the protein made by 1 gene controls many different traits –Eye color, skin color, and hair color are examples of this

11. Mutations Mutations are changes in the sequence of the DNA or RNA bases Mutations can happen at random as the DNA or RNA is copied or they can be caused by mutagens –Mutagens are substances that can cause mutations Examples of mutagens: –Radiation from X-rays, sunlight, and radioactive materials –Some food additives –Some industrial chemicals

12. Some mutations cause new proteins to be made, which could lead to new traits (possibly good, possibly bad) Some mutations cause proteins not to be made, which could be good or bad depending on what the protein did Original SequenceMutated Sequence DNA T A CA G TC C GC A TA T TT A CA G TC T GC A TA T T RNA AUGUCAGGCGUAUAAAUGUCAGGCGGCGUAUAA Amino Acids MetSerGlyValStopMetSerAspValStop Original SequenceMutated Sequence DNA T A CA G TC C GC A TA T TT A CA C TC C GC A TA T T RNA AUGUCAGGCGUAUAAAUGUGAUGAGGCGUAUAA Amino Acids MetSerGlyValStopMetStopGlyValStop

13. Some mutations cause no changes in the protein at all Putting it all together: All traits are part genetic and part environmental –Some are more genetic –Some are more environmental –Some are well balanced The environment can alter the traits at any of the levels above Original SequenceMutated Sequence DNA T A CA G TC C GC A TA T TT A CA G TC C GC A AA T T RNA AUGUCAGGCGUAUAAAUGUCAGGCGUUUAA Amino Acids MetSerGlyValStopMetSerGlyValStop