1. Last lecture summary

2. Sequencing strategies
Hierarchical genome shotgun HGS – Human Genome Project
“map first, sequence second”
clone-by-clone … cloning is performed twice (BAC, plasmid)

3. Sequencing strategies
Whole genome shotgun WGS – Celera
shotgun, no mapping
Coverage - the average number of reads representing a given nucleotide in the reconstructed sequence. HGS: 8, WGS: 20

4. Human genome 3 billions bps, ~20 000 – 25 000 genes
Only 1.1 – 1.4 % of the genome sequence codes for proteins.
State of completion:
best estimate – 92.3% is complete
problematic unfinished regions: centromeres, telomeres (both contain highly repetitive sequences), some unclosed gaps
It is likely that the centromeres and telomeres will remain unsequenced until new technology is developed
Genome is stored in databases
Primary database – Genebank (
Additional data and annotation, tools for visualizing and searching
UCSCS (
Ensembl (

5. New stuff

6. Personal human genomes
Personal genomes had not been sequenced in the Human Genome Project to protect the identity of volunteers who provided DNA samples.
Following personal genomes were available by July 2011:
Japanese male (2010, PMID: )
Korean male (2009, PMID: )
Chinese male (2008, PMID: )
Nigerian male (2008, PMID: )
J. D. Watson (2008, PMID: )
J. C. Venter (2007, PMID: )
HGP sequence is haploid, however, the sequence maps of Venter and Watson are diploid.

7. Next generation sequencing (NGS)
The completion of human genome was just a start of modern DNA sequencing era – “high-throughput next generation sequencing” (NGS).
New approaches, reduce time and cost.
Holly Grail of sequencing – complete human genome below $ 1000.

8. 1st and 2nd generation of sequencers
1st generation – ABI Prism 3700 (Sanger, fluorescence, 96 capillaries), used in HGP and in Celera
Sanger method overcomes NGS by the read length (600 bps)
2nd generation - birth of HT-NGS in Life Sciences developed GS 20 sequencer. Combines PCR with pyrosequencing.
Pyrosequencing – sequencing-by-synthesis
Relies on detection of pyrophosphate release on nucleotide incorporation rather than chain termination with ddNTs.
The release of pyrophosphate is detected by flash of light (chemiluminiscence).
Average read length: 400 bp
Roche GS-FLX 454 (successor of GS 20) used for J. Watson’s genome sequencing.
Show video Show Pyrosequencing.flv
PYROSEQUENCING
- "Sequencing by synthesis" involves taking a single strand of the DNA to be sequenced and then synthesizing its complementary strand enzymatically. The pyrosequencing method is based on detecting the activity of DNA polymerase (a DNA synthesizing enzyme) with another chemiluminescent enzyme. Essentially, the method allows sequencing of a single strand of DNA by synthesizing the complementary strand along it, one base pair at a time, and detecting which base was actually added at each step. The template DNA is immobile, and solutions of A, C, G, and T nucleotides are sequentially added and removed from the reaction. Light is produced only when the nucleotide solution complements the first unpaired base of the template. The sequence of solutions which produce chemiluminescent signals allows the determination of the sequence of the template.
- Based on excellent and up-to-date review Pareek CS, Smoczynski R, Tretyn A. Sequencing technologies and genome sequencing. J Appl Genet Jun 23. PubMed PMID:

9. 3rd generation
2nd generation still uses PCR amplification which may introduce base sequence errors or favor certain sequences over others.
To overcome this, emerging 3rd generation of seqeuencers performs the single molecule sequencing (i.e. sequence is determined directly from one DNA molecule, no amplification or cloning).
Compared to 2nd generation these instruments offer higher throughput, longer reads (~1000 bps), higher accuracy, small amount of starting material, lower cost

10. Moore’s law
Na tabuli kridou kreslit a vysvetlovat Mooruv zakon a logaritmickou osu na grafu
1) Mooruv zakon – zdvojnasobeni vypocetni sily kazde dva roky. Ted je vypocetni sila n, za dva roky je 2n, za dalsi dva roky je 2*2n=4n, za dlais dva roky je 2*4n=8n, pak 16n atd. S linearni y osou je to parabola.
2) Kdyz chci, aby byly na y ose vzdalenosti mezi 2n, 4n, 8n, 16, … ekvidistantni, co musim udelat? Vzit log, protoze mam log(2n), log(4n)=log(2^2n)=2xlog(2n), log(8n)=3xlog(2n),… v logaritmicke ose pak bude Mooruv zakon primka.

11. transition to 2nd generation
source:
transition to 2nd generation
5,000$
4,905 $
0.054$

12. Illumina HiSeq X Ten
Illumina anounced the new HiSeq X Ten Sequencing System.
Illumina claims they are enabling the $1,000 genome.
Uses Illumina SBS technology (sequencing-by-synthesis).
It sells for at least $10 million.

13. Human Longevity
– Human Longevity was founded by Craig Venter
Its main aim: to slow down the process of ageing
The largest human DNA sequencing operation in the world, capable of processing 40,000 human genomes a year.
DNA data will be combined with other data on the health and body composition of the people whose DNA is sequenced, in the hope of gleaning insights into the molecular causes of aging and age-related illnesses like cancer and heart disease.
Equipment: 2x Illumina Hiseq X Ten

14. Which genomes were sequenced?
GOLD – Genomes online database (
information regarding complete and ongoing genome projects

15. Important genomics projects
The analysis of personal genomes has demonstrated, how difficult is to draw medically or biologically relevant conclusions from individual sequences.
More genomes need to be sequenced to learn how genotype correlates with phenotype.
1000 Genomes project ( started in Sequence the genomes of at least a 1000 people from around the world to create the detailed and medically useful picture of human genetic variation.
2nd generation of sequencers is used in 1000 Genomes.
Genomes will start soon.

16. Important genomics projects
ENCODE project (ENCyclopedia Of DNA Elements,
by NHGRI
identify all functional elements in the human genome sequence
Defined regions of the human genome corresponding to 30Mb (1%) have been selected.
These regions serve as the foundation on which to test and evaluate the effectiveness and efficiency of a diverse set of methods and technologies for finding various functional elements in human DNA.

17. Sequence Alignment

18. What is sequence alignment ?
CTTTTCAAGGCTTA
GGCTTATTATTGC
Fragment overlaps
CTTTTCAAGGCTTA
GGCTATTATTGC
navozeni squence alignmentu na prikladech, kdy se tento objevuje v predchozim vykladu
nahore je presny overlap
dole je priblizny overlap, jsou ukazana dve zarovnani, zarovnani s vlozenou mezerou je vice optimalni
CTTTTCAAGGCTTA
GGCT-ATTATTGC

19. What is sequence alignment ?
CCCCATGGTGGCGGCAGGTGACAG
CATGGGGGAGGATGGGGACAGTCCGG TTACCCCATGGTGGCGGCTTGGGAAACTT
TGGCGGCTCGGGACAGTCGCGCATAAT
CCATGGTGGTGGCTGGGGATAGTA
TGAGGCAGTCGCGCATAATTCCG
CCCCATGGTGGCGGCAGGTGACAG
CATGGGGGAGGATGGGGACAGTCCGG TTACCCCATGGTGGCGGCTTGGGAAACTT
TGGCGGCTCGGGACAGTCGCGCATAAT
CCATGGTGGTGGCTGGGGATAGTA
TGAGGCAGTCGCGCATAATTCCG
toto je pouze demonstracni zarovnani
clustering vede ke konsensualni sekvenci
TTACCCCATGGTGGCGGCTGGGGACAGTCGCGCATAATTCCG
consensus

20. Sequence alphabet Adenine A Thymine T Cytosine G Guanine C Name
side chain charge at physiological pH 7.4
Name
3 letters
1 letter
Positively charged side chains
Arginine
Arg R
Histidine
His H
Lysine
Lys K
Negatively charged side chains
Aspartic Acid
Asp D
Glutamic Acid
Glu E
Polar uncharged side chains
Serine
Ser S
Threonine
Thr T
Asparagine
Asn N
Glutamine
Gln Q
Special
Cysteine
Cys C
Selenocysteine
Sec U
Glycine
Gly G
Proline\
Pro P
Hydrophobic side chains
Alanine
Ala A
Leucine
Leu L
Isoleucine
Ile I
Methionine
Met M
Phenylalanine
Phe F
Tryptophan
Trp W
Tyrosine
Tyr Y
Valine
Val V
Adenine A
Thymine T
Cytosine G
Guanine C

21. Sequence alignment Procedure of comparing sequences
Point mutations – easy
More difficult example
However, gaps can be inserted to get something like this
ACGTCTGATACGCCGTATAGTCTATCT ACGTCTGATTCGCCCTATCGTCTATCT
gapless alignment
ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT
Gaps correspond to inserion in one sequnce, or deletion in another. (indel)
Comparing two genes it is generally impossible to tell if an indel is an insertion in one gene, or a deletion in another, unless ancestry is known: ACGTCTGATACGCCGTATCGTCTATCT ACGTCTGAT---CCGTATCGTCTATCT
ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT
gapped alignment
insertion × deletion
indel

22. Why align sequences – continuation
The draft human genome is available
Automated gene finding is possible
Gene: AGTACGTATCGTATAGCGTAA
What does it do?
One approach: Is there a similar gene in another species?
Align sequences with known genes
Find the gene with the “best” match

23. Flavors of sequence alignment
pair-wise alignment × multiple sequence alignment
- párové/násobné zarovnání -

24. Flavors of sequence alignment
global alignment × local alignment
global
align entire sequence
stretches of sequence with the highest density of matches are aligned, generating islands of matches or subalignments in the aligned sequences
- Sequences that are quite similar and approximately the same length are suitable candidates for global alignment.
- Local alignments are more suitable for aligning sequences that are similar along some of their lengths but dissimilar in others, sequences that differ in length, or sequences that share a conserved region or domain.
local

25. Evolution
common ancestors
wikipedia.org

26. Evolution of sequences
The sequences are the products of molecular evolution.
When sequences share a common ancestor, they tend to exhibit similarity in their sequences, structures and biological functions.
DNA1
DNA2
Protein1
Protein2
- similar sequences produce similar proteins – this is probably the most powerful idea of bioinformatics because it enables us to make predictions. Often little is known about the function of new sequence from a genome sequencing program, but if similar sequences can be found in a database for which functional or structural information is available, then this can be used as the basis of a prediction of function or structure for the new sequence.
Sequence similarity
Similar 3D structure
Similar function
Similar sequences produce similar proteins
However, this statement is not a rule. See Gerlt JA, Babbitt PC. Can sequence determine function? Genome Biol. 2000;1(5) PMID:

27. Homology
During the time period, the molecular sequences undergo random changes, some of which are selected during the process of evolution.
Selected sequences accumulate mutations, they diverge over time.
Two sequences are homologous when they are descended from a common ancestor sequence.
Traces of evolution may still remain in certain portions of the sequences to allow identification of the common ancestry.
Residues performing key roles are preserved by natural selection, less crucial residues mutate more frequently.

28. Orhology, paralogy I
Orthologs – homologous proteins from different species that possess the same function (e.g. corresponding kinases in signal transduction pathway in humans and mice)
Paralogs – homologous proteins that have different function in the same species (e.g. two kinases in different signal transduction pathways of humans)
However, these terms are controversially discussed:
Jensen RA. Orthologs and paralogs - we need to get it right. Genome Biol. 2001;2(8), PMID: and references therein
two flavors of homology
kinase: phospohorylation, transfers phosphate groups from high-energy donor molecules, such as ATP, to specific substrates

29. Orthology, paralogy II Orthologs – genes separated by the
event of speciation
Sequences are direct descendants of a
common ancestor.
Most likely have similar domain structure, 3D structure and biological function.
Paralogs – genes separated by the event of genetic duplication
Gene duplication: An extra copy of a gene. Gene duplication is a key mechanism in evolution. Once a gene is duplicated, the identical genes can undergo changes and diverge to create two different genes.

30. Gene duplication Unequal cross-over
Entire chromosome is replicated twice
This error will result in one of the daughter cells having an extra copy of the chromosome. If this cell fuses with another cell during reproduction, it may or may not result in a viable zygote.
Retrotransposition
Sequences of DNA are copied to RNA and then back to DNA instead of being translated into proteins resulting in extra copies of DNA being present within cell.
Gene duplication is believed to play a major role in evolution;
Duplications typically arise from an event termed
unequal crossing-over (recombination) that occurs between misaligned homologous chromosomes during meiosis (germ cell formation). The chance of this event happening is a function of the degree of sharing of repetitive elements between two chromosomes. The recombination products of such an event are a duplication at the site of the exchange and a reciprocal deletion.
Another way that gene duplication can occur is if the entire chromosome is replicated twice. This error will result in one of the daughter cells having an extra copy of the chromosome and all the extra genetic material. If this cell fuses with another cell during reproduction, it may or may not result in a viable zygote.
The last way that gene duplication can occur is through retrotransposition. During retrotransposition, sequences of DNA are copied to RNA and then back to DNA instead of being translated into proteins. This results in extra copies of that DNA being present within the cell, which can rejoin with the chromosomes that are already present. Any genes found along these sequences of DNA will have been duplicated in the process.

31. Unequal cross-over
Homologous chromosomes are misaligned during meiosis.
The probability of misalignment is a function of the degree of sharing the repetitive elements.
The underlying DNA sequence homology of the similar maternal and paternal chromosome pairs guides this search and eventual alignment along the entire length of each chromosome. The alignment is further mediated and cemented by a three-dimensional zipperlike structure surrounding each set of paired homologous chromosomes, the synaptonemal complex.
Read more: Meiosis - Biology Encyclopedia - cells, plant, body, human, process, different, chromosomes, DNA, organs

32. Comparing sequences through alignment – patterns of conservation and variation can be identified.
The degree of sequence conservation in the alignment reveals evolutionary relatedness of different sequences
The variation between sequences reflects the changes that have occurred during evolution in the form of substitutions and/or indels.
Identifying the evolutionary relationships between sequences helps to characterize the function of unknown sequences.
Protein sequence comparison can identify homologous sequences from common ancestor 1 billions year ago (BYA). DNA sequences typically only 600 MYA.