2.  DNA, as genetic blueprint of life, dictates how to make every living thing  Every cell’s job is to produce protein › Why protein?  Animals: enzymes, membranes, organelles, muscle, skin, hair = protein  Plants: enzymes, membranes, organelles = protein  Life = protein!

3.  Making protein is cell’s doctrine or dogma › Central dogma: steps necessary to produce protein  Step 1: DNA transcribed to RNA  Step 2: RNA translated to protein

5.  Double-stranded (ds) DNA found in nucleus of eukaryotes (cytoplasm of prokaryotes)  Code of bases (A-C-G-T) on DNA determines what type of protein synthesized in cytoplasm › Problem: DNA trapped in nucleus, can’t leave › Solution: use different nucleic acid that’s able to leave nucleus = single-stranded (ss) RNA!

6.  Step 1: RNA polymerase binds to DNA  Step 2: RNA polymerase unwinds & unzips DNA  Step 3: RNA polymerase adds complementary RNA bases to DNA › All bases are same as DNA except RNA uses uracil instead of thymine DNA: A T C C A G G T C A T G C A A G C RNA: RNA: U A G G U C C A G U A C G U U C G

8. DNA RNA PO 4 Nucleic acid adenine cytosine guanine Single- strand uracil ribose double -strand Deoxy -ribose thymine

10.  Txn can occur at different DNA forks (just like replication) › Different segments of DNA called “genes” that code for different proteins/items T A C G A T T A C A G C A Gene 1

11.  Three types of RNA made depending on work needed 1.Messenger RNA (mRNA)  brings information from DNA in nucleus to outside cytoplasm 2.Ribosomal RNA (rRNA)  Contains ribosome that clamps onto mRNA put amino acids in right order 3.Transfer RNA (tRNA)  carries amino acids to rRNA for assembly

12.  Act of making protein from mRNA › Recall: amino acids are building blocks of proteins  mRNA sequence is “read” › Nucleotide sequence codes for 20 different types of amino acids › Group of 3 nucleotides (triplet or codon ) codes for 1 amino acid  Ex: UUU codes for phenylalanine UAC codes for tyrosine

13. Ex: AAC = asparagine

14.  Let’s practice:  Step 1: put blocks around every 3 bases (1 codon)  Step 2: look up letters in mRNA code  Step 3: write down amino acid sequenceAAACCUAAGGCCAACCUAAGGACC lysine- proline- lysine - alanine- asparagine - arginine- threonine - leucine

15.  Trl has repetition to compensate for possible mistakes & codes to start & stop › Repetition: proline is coded for by CCU, CCC, and CCA › Start: codon AUG is where tln starts (methionine) › Stop: codons UGA, UAA, UAG where trl stops › Try it again!  Do NOT start boxing codons until see START codon “AUG”  Stop translating when see STOP codon (UGA, UAA, or UAG) AACCAUGAAGGCCAACCUAUAGGACCG Protein = methionine–lysine-alanine-asparagine-leucine

17.  1. DNA undergoes txn to make mRNA in nucleus  2. mRNA leaves nucleus, enters cytoplasm & travels to ribosome (solo or on roughER)  3. tRNA binds to amino acids in cytoplasm based on anticodon & transports them to ribosome  4. ribosome bonds codon in mRNA to anticodons in tRNA, binding amino acids in right order until reaches STOP codon

18. dsDNA mRNA tRNA ribosome amino acid

19. dsDNA mRNA

20. dsDNA mRNA

21. dsDNA mRNA tRNAtry ACC Amino acid anticodon

22. Ribosome tRNA CUAmettRNA UAhis G GAU GAUU GAAU GC mRNA tRNA Atry CC

23. Ribosome (rRNA) GAU GAUU GAAU GC mRNA tRNA CUA methis tRNA UAG tRNA A try CC