1. Genetic Information Week 13: 7-8/12/2011 Sem 1, 2011/2012

2. Introduction General outline of biological inheritence and information transfer. General outline of biological inheritence and information transfer. - Info encoded within DNA, directs the functioning of living cells and is transmitted to offspring, consists of specific sequence of nitrogenous bases. DNA synthesis involves the complementary pairing of nucleotide bases on 2 strands of DNA. - Mechanism by which genetic info is decoded and used to direct cellular processes begins with the synthesis of RNA. RNA synthesis- complimentary pairing of ribonucleotide bases with bases in DNA molecule. - Several types of RNA involved in the synthesis of enzymes, structural proteins and other types of polypeptides required for the synthesis of biomolecules.

3. Central dogma of molecular biology translation transcription replication DNARNAPROTEIN Solid arrow indicate types of information transfers that occur in cells. DNA directs its own replication to produce new DNA molecule; DNA is transcribes into RNA; RNA is translated into protein. The dashed lines represent information transfers that occur in certain organisms. Describe the flow of genetic information from DNA through RNA and eventually to protein <------------------

4. Information Flow DNA RNA Protein Replication: DNA duplicates itself Transcription: RNA is made on a DNA template Translation: Protein is synthesized from AAs and the three RNAs. Reverse Transcription: RNA directs synthesis of DNA RNA replication: RNA replicates itself

5. Because of the importance of DNA, living organisms must possess: Because of the importance of DNA, living organisms must possess: - Rapid and accurate DNA synthesis - Genetic stability- effective DNA repair mechanisms. Prokaryotic genetic information processes are more understood than those eukaryotes- minimal growth requirements, short generation times, simple genetic composition. Prokaryotic genetic information processes are more understood than those eukaryotes- minimal growth requirements, short generation times, simple genetic composition. Common method in genetic research- induce mutation- observe changes. Common method in genetic research- induce mutation- observe changes.

6. DNA replication DNA replication is an anabolic polymerization process, that allows a cell to pass copies of its genome to its descendants. DNA replication is an anabolic polymerization process, that allows a cell to pass copies of its genome to its descendants. Must occur before every cell division Must occur before every cell division After two strands of DNA separate, each serves as template for the synthesis of a complementary strand. After two strands of DNA separate, each serves as template for the synthesis of a complementary strand. Biologists say that DNA replication is semiconservative replication because each daughter DNA molecule is composed of one original strand and one new strand. Biologists say that DNA replication is semiconservative replication because each daughter DNA molecule is composed of one original strand and one new strand.

7. PRINCIPAL OF DNA REPLICATION Discovered by Matthew Meselson and Franklin Stahl, 1958.

9. c) Synthesis of lagging strand DNA REPLICATION PROCESS

10. Initial Processes in DNA Replication DNA replication begins at a specific sequence of nucleotides called an origin. DNA replication begins at a specific sequence of nucleotides called an origin. First, a cell removes chromosomal proteins, exposing the DNA helix. First, a cell removes chromosomal proteins, exposing the DNA helix. DNA unwinding DNA unwinding An enzyme called DNA helicase locally "unzips/unwind" the DNA molecule by breaking the hydrogen bonds between complementary nucleotide bases, which exposes the bases in a replication fork. Other protein molecules stabilize the single strands so that they do not rejoin while replication proceeds An enzyme called DNA helicase locally "unzips/unwind" the DNA molecule by breaking the hydrogen bonds between complementary nucleotide bases, which exposes the bases in a replication fork. Other protein molecules stabilize the single strands so that they do not rejoin while replication proceeds

11. Primer synthesis Primer synthesis - Formation of short RNA segments called primers- required for the initiation of DNA replication (catalyzed by primase, RNA polymerase). DNA synthesis DNA synthesis - The synthesis of a complementary DNA strand by forming phosphodiester linkages between nucleotides base-paired to a template strand is catalyzed by an enzyme DNA polymerase.

12. DNA polymerases III replicate DNA in only one direction - 5' to 3' - like a jeweler stringing pearls to make a necklace, adding them one at a time, always moving from one end of the string to the other. DNA polymerases III replicate DNA in only one direction - 5' to 3' - like a jeweler stringing pearls to make a necklace, adding them one at a time, always moving from one end of the string to the other. Besides DNA polymerase III, DNA polymerase I and DNA polymerase II. Besides DNA polymerase III, DNA polymerase I and DNA polymerase II. DNA polymerase I- DNA repair enzyme and removing RNA primer during replication. DNA polymerase I- DNA repair enzyme and removing RNA primer during replication. DNA polymerase II- similar to DNA pol II. DNA polymerase II- similar to DNA pol II.

13. Because the two original (template) strands are antiparallel cells synthesize new strands in two different ways: Because the two original (template) strands are antiparallel cells synthesize new strands in two different ways: 1) One new strand, called the leading strand, is synthesized continuously as a single long chain of nucleotides. 2)The other new strand, called the lagging strand, is synthesized in short segments that are later joined by DNA ligase (Okazaki fragments).

15. Synthesis of the Leading Strand A cell synthesizes a leading strand toward the replication fork in the following series of five steps 1) An enzyme called primase synthesizes a short RNA molecule that is complementary to the template DNA strand. This RNA primer provides the 3' hydroxyl group required by DNA polymerase. 2) Triphosphate deoxyribonucleotides form hydrogen bonds with their complements in the parental strand. Adenine nucleotides bind to thymine nucleotides, and guanine nucleotides bind to cytosine nucleotides. 3) Using the energy in the high-energy bonds of the triphosphate deoxyribonucleotides, DNA polymerase III covalently joins them one at a time by dehydration synthesis to the leading strand.

16. 4) DNA polymerase III also performs a proofreading function. About 1 out of every 100,000 nucleotides is mismatched with its template; for instance, a guanine might become incorrectly paired with a thymine. DNA polymerase III recognizes most such errors and removes the incorrect nucleotides before proceeding with synthesis. This role, known as the proofreading exonuclease function, acts like the delete key on a keyboard, removing the most recent error. DNA polymerase III recognizes most such errors and removes the incorrect nucleotides before proceeding with synthesis. This role, known as the proofreading exonuclease function, acts like the delete key on a keyboard, removing the most recent error. Because of this proofreading exonuclease function, only about one error remains for every ten billion (10 10 ) base pairs replicated. Because of this proofreading exonuclease function, only about one error remains for every ten billion (10 10 ) base pairs replicated. 5) Another DNA polymerase - DNA polymerase I - ­replaces the RNA primer with DNA. Note that researchers named DNA polymerase enzymes in the order of their discovery, not the order of their actions.

17. Synthesis of the Lagging Strand The steps in the synthesis of a lagging strand are as follows : The steps in the synthesis of a lagging strand are as follows : The discontinuous synthesis on the lagging strand requires primer synthesis for each of the Okazaki fragments. The discontinuous synthesis on the lagging strand requires primer synthesis for each of the Okazaki fragments. The primosome travels along the lagging strand and stops and reverses direction at intervals to synthesize a short RNA primer. The primosome travels along the lagging strand and stops and reverses direction at intervals to synthesize a short RNA primer. Nucleotides pair up with their complements in the template-adenine with thyamine, and cytosine with guanine. Nucleotides pair up with their complements in the template-adenine with thyamine, and cytosine with guanine.

18. DNA polymerase III joins neighboring nucleotides and proofreads. Each Okazaki fragment requires a new RNA primer and consists of 1000 to 2000 nucleotides. DNA polymerase III joins neighboring nucleotides and proofreads. Each Okazaki fragment requires a new RNA primer and consists of 1000 to 2000 nucleotides. DNA polymerase I replaces the RNA primers of Okazaki fragments with DNA and further proofreads the daughter strand. DNA polymerase I replaces the RNA primers of Okazaki fragments with DNA and further proofreads the daughter strand. DNA ligase seals the gaps between adjacent Okazaki fragments to form a continuous DNA strand. DNA ligase seals the gaps between adjacent Okazaki fragments to form a continuous DNA strand.

19. Transcription TRANSCRIPTION is the synthesis of RNA under the direction of DNA TRANSCRIPTION is the synthesis of RNA under the direction of DNA DNA strand provide a template for assembling a sequence of RNA nucleotides DNA strand provide a template for assembling a sequence of RNA nucleotides The resulting RNA molecule is the transcript of the gene’s protein-building instruction The resulting RNA molecule is the transcript of the gene’s protein-building instruction Called mRNA (messenger RNA) – carry genetic message from DNA Called mRNA (messenger RNA) – carry genetic message from DNA

21. TRANSCRIPTION Cells transcribe four main types of RNA from DNA : Cells transcribe four main types of RNA from DNA : RNA primer molecules for DNA polymerase to use during DNA replication RNA primer molecules for DNA polymerase to use during DNA replication messenger RNA (mRNA) molecules, which carry genetic information from chromosomes to ribosomes messenger RNA (mRNA) molecules, which carry genetic information from chromosomes to ribosomes ribosomal RNA (rRNA) molecules, which combine with ribosomal polypeptides to form ribosomes-the organelles that synthesize polypeptides ribosomal RNA (rRNA) molecules, which combine with ribosomal polypeptides to form ribosomes-the organelles that synthesize polypeptides transfer RNA (tRNA) molecules, which deliver amino acids to the ribosomes transfer RNA (tRNA) molecules, which deliver amino acids to the ribosomes

23. Initiation of Transcription RNA polymerases - the enzymes that synthesize RNA RNA polymerases - the enzymes that synthesize RNA RNA polymerase bind to specific nucleotide sequences called promoter - include the transcription startpoint (the nucleotides where RNA synthesis begin) RNA polymerase bind to specific nucleotide sequences called promoter - include the transcription startpoint (the nucleotides where RNA synthesis begin)

24. Initiation of Transcription Prokaryotic promoters- variable in size (from 20bp – 200 bp), 2 short sequences at positions about 10 and 35 bp upstream of the transcription initiation site are remarkably similar among bacterial species (consensus sequences). Prokaryotic promoters- variable in size (from 20bp – 200 bp), 2 short sequences at positions about 10 and 35 bp upstream of the transcription initiation site are remarkably similar among bacterial species (consensus sequences). -10 region- Pribnow box. -10 region- Pribnow box. RNA polymerase slides along the DNA until it reaches a promoter sequence. RNA polymerase slides along the DNA until it reaches a promoter sequence. Once it bind to the promoter sequence, RNA polymerase unwinds and unzips the DNA molecule in the promoter region Once it bind to the promoter sequence, RNA polymerase unwinds and unzips the DNA molecule in the promoter region After unzip, RNA polymerase initiate RNA synthesis at the promoter on the template strand After unzip, RNA polymerase initiate RNA synthesis at the promoter on the template strand

25. When the transcribed sequence reaches a length of about 10 nucleotides, the conformation of the RNA complex changes: for e.g the σ factor is released- initiation phase ends. When the transcribed sequence reaches a length of about 10 nucleotides, the conformation of the RNA complex changes: for e.g the σ factor is released- initiation phase ends.

26. Elongation of the RNA Transcript Once the factor detaches, the affinity of the RNA polymerase complex for the promoter site decreases- the elongation phase begins. Once the factor detaches, the affinity of the RNA polymerase complex for the promoter site decreases- the elongation phase begins. As RNA polymerase moves along the DNA, it continues to untwist the double helix for pairing with RNA nucleotides As RNA polymerase moves along the DNA, it continues to untwist the double helix for pairing with RNA nucleotides The enzyme add nucleotides to the 3’ end of the growing RNA molecule as it continues along the double helix The enzyme add nucleotides to the 3’ end of the growing RNA molecule as it continues along the double helix

27. Elongation of the RNA Transcript In the wake of transcription, the DNA strands re-form the double helix and the new RNA molecule peels away from its DNA. In the wake of transcription, the DNA strands re-form the double helix and the new RNA molecule peels away from its DNA. The incorporation of the ribonucleotides continues until a termination signal is reached. The incorporation of the ribonucleotides continues until a termination signal is reached.

28. Termination of Transcription Transcription proceeds until shortly after the RNA polymerase transcribes a DNA sequence called a terminator Transcription proceeds until shortly after the RNA polymerase transcribes a DNA sequence called a terminator Termination sequences contain palindromes. Termination sequences contain palindromes. The RNA transcript of the DNA palindrome forms a stable hairpin turn- this structure disrupts the RNA- DNA hybrid structure. The RNA transcript of the DNA palindrome forms a stable hairpin turn- this structure disrupts the RNA- DNA hybrid structure. After the RNA is released, the polymerase dissociate from the DNA After the RNA is released, the polymerase dissociate from the DNA

29. TRANSLATION Translation is the process whereby ribosomes use the genetic information of nucleotide sequences to synthesize polypeptides composed of specific amino acid sequences. Translation is the process whereby ribosomes use the genetic information of nucleotide sequences to synthesize polypeptides composed of specific amino acid sequences.

31. In translation process, cell interprets a genetic message and builds a protein In translation process, cell interprets a genetic message and builds a protein Message = is a series of codons along an mRNA molecule Message = is a series of codons along an mRNA molecule Interpreter = transfer RNA (tRNA) Interpreter = transfer RNA (tRNA) tRNA = transfer amino acids from cytoplasm’s amino acid pool to ribosome tRNA = transfer amino acids from cytoplasm’s amino acid pool to ribosome The ribosome adds each amino acid brought to it by tRNA to the growing end of a polypeptide chain The ribosome adds each amino acid brought to it by tRNA to the growing end of a polypeptide chain

32. As a tRNA molecule arrives at a ribosome, it bears a specific amino acid at one end. As a tRNA molecule arrives at a ribosome, it bears a specific amino acid at one end. At the other end is a nucleotide triplet called an anticodon, which binds according to base- pairing rules to a complementary codon on mRNA. At the other end is a nucleotide triplet called an anticodon, which binds according to base- pairing rules to a complementary codon on mRNA.

33. How do ribosomes interpret the nucleotide sequence of mRNA to determine the correct order in which to assemble amino acids? How do ribosomes interpret the nucleotide sequence of mRNA to determine the correct order in which to assemble amino acids?

34. The genetic code During protein synthesis, nucleic acid base sequence is converted to amino acid sequence- translation During protein synthesis, nucleic acid base sequence is converted to amino acid sequence- translation Is a coding dictionary that specifies a meaning for a base sequence Is a coding dictionary that specifies a meaning for a base sequence the genetic code define as triplets of mRNA nucleotides called codons that code for specific amino acids. the genetic code define as triplets of mRNA nucleotides called codons that code for specific amino acids. 64 possible arrangements - more than enough to specify 21 amino acids. 64 possible arrangements - more than enough to specify 21 amino acids.

35. 61 codons specify amino acids and 3 codons 61 codons specify amino acids and 3 codons -UAA, UAG, and UGA-to stop translating UGA codes for the 21st amino acid, selenocysteine. UGA codes for the 21st amino acid, selenocysteine. Codon AUG also has a dual function, acting as both a start signal and coding for an amino acid – methionine. Codon AUG also has a dual function, acting as both a start signal and coding for an amino acid – methionine.

36. Genetic code possess the following properties: Degenerate Degenerate - Several signals have the same meaning. - The genetic code is partially degenerate because most amino acids are coded for by several codons. - For eg: Leu is coded by 6 different codons.

37. Specific Specific - Each codon is a signal for a specific amino acid. - Majority of codons that code for the same amino acid possess similar sequences. - For eg: serine (UCU, UCC, UCA and UCG)- the first and second bases are identical. - Consequently, a point mutation in the third base of a serine codon would not be deleterious.

38. Nonoverlapping and without punctuation Nonoverlapping and without punctuation - mRNA coding sequence is read by a ribosome starting from the initiating codon (AUG) as a continuous sequence taken 3 bases at a time until a stop codon is reached. - A set of contiguous triplet codons in an mRNA is called a reading frame. - Open reading frame (orf)- series of triplet base sequuences in mRNA that do not contain a stop codon.

39. Universal Universal - Coding signals for amino acids are always the same.

41. AUG = start codon

43. Protein Synthesis The translation of a genetic message into the primary sequence of a polypeptide can be divided into 3 phases. The translation of a genetic message into the primary sequence of a polypeptide can be divided into 3 phases. - Initiation - Elongation - Termination

44. INITIATION Initiation- Small ribosomal subunit binds an mRNA Initiation- Small ribosomal subunit binds an mRNA The anticodon of a specific tRNA (initiator tRNA) base pairs with the initiation codon AUG. The anticodon of a specific tRNA (initiator tRNA) base pairs with the initiation codon AUG. Iniation ends as the large ribosomal subunit combines with small subunit. Iniation ends as the large ribosomal subunit combines with small subunit. There are 2 sites on the complete ribosome for codon- anticodon interactions There are 2 sites on the complete ribosome for codon- anticodon interactions

45. There are 2 sites on the complete ribosome for codon-anticodon interactions: There are 2 sites on the complete ribosome for codon-anticodon interactions: - The P (peptidyl) site- now occupied with initiator - The A (aminoacyl) site

46. ELONGATION During elongation- polypeptide is synthesized according to the genetic message. During elongation- polypeptide is synthesized according to the genetic message. The message is read from 5’-3’ direction- polypeptide synthesis proceeds from the N- terminal to C-terminal. The message is read from 5’-3’ direction- polypeptide synthesis proceeds from the N- terminal to C-terminal. Elongation begins- as a second aminoacyl- tRNA becomes bound to the ribosome in A site becoz of codon-aticodon base pairing. Elongation begins- as a second aminoacyl- tRNA becomes bound to the ribosome in A site becoz of codon-aticodon base pairing.

47. Peptide bond formation is catalyzed by peptidyl transferase- the amino group of A site amino acid attacks the carbonyl group of P site a.a. both a.a are attached to the A site tRNA. Peptide bond formation is catalyzed by peptidyl transferase- the amino group of A site amino acid attacks the carbonyl group of P site a.a. both a.a are attached to the A site tRNA. The uncharged tRNA at P site moves to E site. The uncharged tRNA at P site moves to E site. Next step- translocation- the ribosome moved along mRNA. Next step- translocation- the ribosome moved along mRNA. As the mRNA moves, the next codon enters A site, and the tRNA bearing the growing polypeptide chain moves to P site. As the mRNA moves, the next codon enters A site, and the tRNA bearing the growing polypeptide chain moves to P site.

48. The ribosome releases the “empty" tRNA from the E site. In the cytosol, the appropriate enzyme recharges it with another molecule of its specific amino acid. The ribosome releases the “empty" tRNA from the E site. In the cytosol, the appropriate enzyme recharges it with another molecule of its specific amino acid. The cycle repeats, each time adding another amino acid (in this case, threonine, then alanine, and then glutamine) until a stop codon enters the A site. The cycle repeats, each time adding another amino acid (in this case, threonine, then alanine, and then glutamine) until a stop codon enters the A site.

49. TERMINATION During termination the polypeptide chain is released from the ribosome. During termination the polypeptide chain is released from the ribosome. Translation terminates because a stop codon cannot bind an aminoacyl-tRNA. Translation terminates because a stop codon cannot bind an aminoacyl-tRNA. Instead, a protein releasing factor binds to the A site. Instead, a protein releasing factor binds to the A site. Subsequently, a peptidyl transferase hydrolyses the bond connecting the now-completed polypeptide and the tRNA in the P site. Subsequently, a peptidyl transferase hydrolyses the bond connecting the now-completed polypeptide and the tRNA in the P site. translation ends as the ribosome releases mRNA and dissociates into small and large subunits. translation ends as the ribosome releases mRNA and dissociates into small and large subunits.

50. Mutations of Genes: Types of mutation Mutations range from large changes in an organism's genome, such as the loss or gain of an entire chromosome, to the most common type of mutation - point mutations - in which just one nucleotide base pair is affected. Mutations range from large changes in an organism's genome, such as the loss or gain of an entire chromosome, to the most common type of mutation - point mutations - in which just one nucleotide base pair is affected. Mutations include base pair insertions, deletions, and substitutions. Mutations include base pair insertions, deletions, and substitutions.

51. Effects of Mutations Some base-pair substitutions produce silent mutations because the substitution does not change the amino acid sequence because of the redundancy of the genetic code. Some base-pair substitutions produce silent mutations because the substitution does not change the amino acid sequence because of the redundancy of the genetic code. For example, when the DNA triplet AAA " is changed to AAG, the mRNA codon will be changed from UUU to UUC; however, because both codons specify the amino acid phenylalanine, there is no change in the phenotype - the mutation is silent because it affects the genotype only. For example, when the DNA triplet AAA " is changed to AAG, the mRNA codon will be changed from UUU to UUC; however, because both codons specify the amino acid phenylalanine, there is no change in the phenotype - the mutation is silent because it affects the genotype only.

52. Of greater concern are substitutions that change a codon for one amino acid into a codon for a different amino acid. Of greater concern are substitutions that change a codon for one amino acid into a codon for a different amino acid. A change in a nucleotide sequence resulting in a codon that specifies a different amino acid is called a missense mutation; what gets transcribed and translated makes sense, but not the right sense. A change in a nucleotide sequence resulting in a codon that specifies a different amino acid is called a missense mutation; what gets transcribed and translated makes sense, but not the right sense. The effect of missense mutations depends on where in the protein the different amino acid occurs. The effect of missense mutations depends on where in the protein the different amino acid occurs. When the different amino is in a critical region of a protein, the protein becomes nonfunctional; however, when the different amino acid is in a less important region, the mutation has no adverse effect. When the different amino is in a critical region of a protein, the protein becomes nonfunctional; however, when the different amino acid is in a less important region, the mutation has no adverse effect.

53. A third type of mutation occurs when a base-pair substitution changes an amino acid codon into a stop codon. A third type of mutation occurs when a base-pair substitution changes an amino acid codon into a stop codon. This is called a nonsense mutation. Nearly all nonsense mutations result in nonfunctional proteins. This is called a nonsense mutation. Nearly all nonsense mutations result in nonfunctional proteins.

54. Frameshift mutations (that is, insertions or deletions) typically result in drastic missense and nonsense mutations, except when the insertion or deletion is very close to the end of a gene Frameshift mutations (that is, insertions or deletions) typically result in drastic missense and nonsense mutations, except when the insertion or deletion is very close to the end of a gene

55. Exercise The following synthetic mRNA sequence codes for the beginning of a polypeptide: The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5’AUGUCUCCUACUGCUGACGAGGGAAG GAGGUGGCUUAUCAUGUUU- 3’ Determine the amino acid sequence of the polypeptide. Determine the amino acid sequence of the polypeptide.