1. Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public Defender Service for the District of Columbia

2. The Big Picture What makes using mtDNA to identify a suspect in a criminal case problematic? o mtDNA is NOT a unique identifier o Frequency of mtDNA is NOT known o Evidentiary value of mtDNA is NOT known

3. Overview Law of admissibility What is mtDNA? Our case experience

4. Standards of Admissibility of Expert Testimony 1. Frye v. United States, 293 F. 1013 (D.C. Cir. 1923). 2. Daubert v. Merrell Dow Pharm., 509 US. 579 (1993)

5. Frye Three requirements 1. Subject matter must be distinctively related to some science, profession, business, or occupation as to be beyond the ken of the average layperson. 2. Witness must have sufficient skill, knowledge, or experience in that field as to aid factfinder. 3. State of the art/knowledge must permit expert to assert a reasonable opinion to be admissible.

6. Frye Technique must be generally accepted in the relevant scientific community Consensus versus controversy over a particular technique, not its validity If scientists significant either in number or expertise oppose new technique as unreliable, then it does not pass muster under Frye. Reliability matters, but court should NOT try to determine which view is valid, but whether or not there is a controversy

7. Daubert The four Daubert criteria for evaluating the admissibility of expert testimony are: 1. Whether the methods upon which the testimony is based are centered upon a testable hypothesis; 2. The known or potential rate of error associated with the method; 3. Whether the method has been subject to peer review; and 4. Whether the method is generally accepted in the relevant scientific community. Judge performs a “gatekeeping” function

8. What is mitochondrial DNA? How is mtDNA different than nuclear DNA?

9. Nuclear DNA DNA in Nucleus of Cell 23 Pairs of Chromosomes 1 set of 23 from Mother, 1 set of 23 from Father

10. What is mtDNA? Energy producing cytoplasmic organelles

11. Maternally Inherited

12. = Same mtDNA= Female= Male

13. Mutation/Heteroplasmy (Change) A change in the number, arrangement, or molecular sequence of a gene For Example: TAGCTACCCCCACGTTAAGATGGGCC TAGCTACCCCCA T GTTAAGATGGGCC Mutation can occur between people over generations Mutation can occur within a person – Person can have different mtDNA sequences – Called heteroplasmy

14. What is the inclusion/exclusion power of mtDNA? NOT a unique identifier Maternal relatives have the SAME mtDNA Non-maternal relatives have DIFFERENT mtDNA Therefore can be used to exclude large groups of people

15. Advantages of mtDNA There are many copies of mitochondria in a cell (as compared to 1 nuclear DNA copy) It is therefore useful when analyzing old or difficult samples (such as bone, hair without roots, and degraded skin or semen), as the higher number of mtDNA copies corresponds to a higher chance of finding mtDNA than nuclear DNA

16. When has mtDNA been used? 1. Mass disasters (9-11) 2. Unknown soldiers / grave sites 3. Ancestry Verification 4. Studying human migration patterns 5. Medical studies 6. Criminal cases/forensic use

17. mtDNA in Criminal Cases No universe of known samples (in most cases) Process: 1. Crime Scene sample mtDNA sequence determined 2. Suspect mtDNA sequence determined 3. Report an inclusion, exclusion, or inconclusive 4. If an inclusion (often inaccurately referred to by the prosecution as a “match”), used as corroborative evidence of identity

18. What does “potentially included” mean? This question is what our admissibility hearing was about When a “match” is reported, it potentially inculpates everyone in that specific maternal line Degree of that inclusion affects relevance and weight of the evidence Most courts only permit introduction of DNA evidence (nuclear or mtDNA) accompanied by some statistical explanation

19. FBI Database Scientific Working Group on DNA Analysis Methods (SWGDAM) Database divided into 14 racial categories (e.g. African-American, Native American, Egyptian) These racial sub-databases have wildly different numbers of profiles Profiles come from “convenience” samples from a few specific locations

20. RaceNumber 11/04 African-Americans1148 Apaches180 Caucasians1814 China/Taiwan356 Egyptians48 Guam87 Hispanics759 India19 Japanese163 Koreans182 Navajos146 Pakistan8 Sierra Leone109 Thai52 TOTAL 5071

21. The “Counting Method” (The prosecution’s statistical mtDNA methodology) Compare suspect sequence to SWGDAM database Report number of times the sequence is in the database Report the number of profiles the sequence was compared against Generate frequency statistic Put confidence interval around frequency statistic Report upper and lower confidence interval There is criticism of this approach

22. Who is Publicly Commenting on mtDNA? In September, American Association of Anthropologists held a conference on race and identity In October, Johns Hopkins held a conference on race and genetics In November, Nature Genetics published a special supplement on race and genetics Lawyers and scientists in courtrooms across the country

23. Potential Attacks on Prosecution’s Statistical Evidence 1. The prosecution undercounts matches in its database a) There are errors in the database b) Heteroplasmy – inconsistent interpretations c) Ignoring Useful, Observed, Relevant Information

24. Potential Attacks (cont) 2. The database is not representative of the relevant population: Database does not take into account migration patterns or regional differences

25. Database Errors Transcription errors – 58% of published mtDNA sequences contained errors of some kind (Peter Forster, To Err is Human, 67 Annals of Human Genetics 2,3 (2003)) SWGDAM found to contain errors Only a small portion of the sequences have had their accuracy manually verified Machine errors – 1% base-calling error rate in its sequencing process

26. HETEROPLASMY A one-base pair difference is not a match for database purposes but is sometimes treated as a match when deciding whether defendant is included as potential contributor

27. FBI Heteroplasmy Analysis in Determining Inclusion Crime Scene Sample: TAGCTACCCCCACGTTAAGATGGGCC Suspect Sample: TAGCTACCCCCATGTTAAGATGGGCC When comparing a crime scene sample with a suspect sample as above, under certain circumstances, the FBI will call the suspect as included as a potential contributor, despite the one-base pair of heteroplasmy present.

28. FBI Heteroplasmy Analysis in Database Comparison Database Sequence: TAGCTACCCCCACGTTAAGATGGGCC Suspect Sample: TAGCTACCCCCATGTTAAGATGGGCC When comparing the suspect sample with the database sequences to determine the number of “matches” in the relevant database, the FBI will NEVER treat the above two sequences as a match. This affects the resulting statistics in a way that does not benefit the suspect.

29. (Under)counting Methods FBI does not count the suspect sample in number of matches FBI does not count the evidence sample in number of matches

30. The database is not representative

31. mtDNA Diversity The FBI assumes mtDNA sequences are homogenous within racial groups Genetic anthropologists disagree Great variety between and within racial groups Must understand migration patterns and geography of samples

32. mtDNA Diversity Many studies have been published that correlate mtDNA genetic variability with geography and immigration history Different geographic regions demonstrate strikingly different mtDNA patterns (including within racial groups)

33. Representative list of articles 1. Yong-Gang Yao et al., Phylogeograhic Differentiation of Mitochondrial DNA in Han Chinese, 70 Am. J. Hum. Genet. 635- 649 (2002); 2. Salas, Antonio, et al., The African Diaspora: Mitochondrial DNA and the Atlantic Slave Trade, 74 Am. J. Hum. Genet. 454-465 (2004); 3. Forster et al., Continental and Subcontinental Distributions of mtDNA Control Region Types, 116 Int. J. Legal Med. 99-108 (2002); 4. Pereira et al., Prehistoric and Historic Traces in the mtDNA of Mozambique: Insights into the Bantu Expansions and the Slave Trade, 65 Am. Hum. Genet., 439-458 (2001); 5. Rando et al., Phylogeographic Patterns of mtDNA Reflecting the Colonization of the Canary Islands, 63 Am. Hum. Genet., 413- 428 (1999).

35. mtDNA, inherited maternally, consists of European haplogroups H, I, J, K, T, U, V, W and X; Asian haplogroups A, B, C, D, F, G, M and Z; and African haplogroups L1, L2 and L3. Asian- and African-specific lineages exist at very low frequencies throughout Europe.

37. FBI View mtDNA sequences in North America demonstrate little to no diversity The types of mtDNA sequences and their frequencies do not vary significantly across the country A sequence derived from a sample collected in D.C. need not be compared against a database of D.C. sequences

38. Documented Regional Differences Regional mtDNA differences in North America have been documented in scientific research 1. Parra & Marcini et al., Estimating African American Admixture Proportions by Use of Populations-Specific Alleles, Am. J. Hun. Genet. 63: 1839-1851 (1998); 2. Parra & Kittles et al., Ancestral Proportions and Admixture Dynamics in Geographically Defined African Americans Living in South Carolina Am. J. Phys. Anthropol. 114:18-29 (2001).

39. Parra & Marcini et al. Study of the amount of African American mtDNA of European derivation in 8 American cities and Jamaica – Charleston 6.46% – Baltimore 14.94% – New York 9.11% – Houston 6.8% – Jamaica 12.93% – Philadelphia – 1 11.02% – Philadelphia – 2 2.84%

40. Parra & Kittles et al. Charleston, South Carolina one of the most important ports in the slave trade from West and Central Africa Extent of European admixture was estimated in six different samples from South Carolina – – Gullah 3.5% – Low Country Berkeley 10.9% Charleston 9.9% Colleton 13.6% Dorchester 14.0% – Columbia 17.7%

41. African-American Migration Patterns Dr. Rick Kittles, a geneticist at Ohio State University: The slave trade in the USA brought about significant regional differences in the ethnic and geographic ancestry of African Americans Different regions in the USA imported slaves from different regions in Africa Grain Coast Africa (Sierra Leone, Liberia, Senegambia)  South Carolina Angola  Louisiana Gold Coast Africa (Ghana)  Bristow & Richmond Region (VA)

44. African-American Database This led to geographic clusters of mtDNA sequences among the African-American population These geographic clusters still exist today Why? Because there are consistent migration patterns in the USA – South Carolina  Philadelphia, New York City – Louisiana  Detroit, Chicago, Cleveland (up Mississippi River) The FBI database does not account for this geographic diversity

45. FBI Native American Database 326 profiles in the database Dr. Frederika Kaestle, a genetic anthropologist at Indiana University, analyzed the database in relation to the extensive research she has conducted on the mtDNA diversity of Native Americans Her analysis showed that entire groups of common sequences were not represented in the database, and that the ones that were represented had significantly different percentages than the percentages found in anthropological databases

46. FBI Native American Database Dr. Kaestle concluded that the FBI Native American database was not representative of the mtDNA diversity of Native American people

48. Conclusions Kittles and Kaestle – Need regional databases – If crime scene sample comes from DC, need a database that consists of DC samples Scholars who study other minority groups agree Scholars who study mtDNA in general agree

49. Our case - U.S. v. Ida Chase mtDNA Admissibility Hearing July 15-22, 2004 The judge ruled mtDNA was admissible The judge has not as yet given a reason for her decision

50. Lessons Learned Need to pursue experts outside of the scientists used by law enforcement and even by other defenders Excite people to work with you Think creatively Change the conversation, do not just challenge the underlying science, here, challenge the concept of identity as defined in the database

51. Fundamental Questions 1. Human genomic variation ask questions about race, ethnicity, ancestry – and individual identification 2. If we do not discuss human genomic variation, we miss the emerging study of: – Who are we – Where do we come from

52. Fundamental Questions 3. FBI / state crime labs/prosecution ignore these questions when using mtDNA evidence to “solve” crimes 4. Our goal in litigation and today: To ensure that science is not abused in court to detriment of persons accused of crimes and facing loss of liberty

53. “[S]cientists [and defense lawyers] are faced with this situation in genomics, where existing biological models or paradigms of ‘racial’ and ‘ethnic’ categorizations cannot accommodate the uniqueness of the individual and universality of human kind that is evident in new knowledge emerging from human genome sequenced variation research and molecular anthropological research.” Royal, C.D.M. & Dunston, G.M. Changing the paradigm from ‘race’ to human genome variation, 36 Nature Genetics Supplement 11 (Nov. 2004).

54. Questions?