Download presentation
Published byLoreen Stephens Modified over 9 years ago
1
Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver
Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar, Roberto Tinoco, Rich Wilson Facilitators: Lisa Elfring and Ralph Preszler
2
Topic: Gene Expression: Linking Genes to Phenotypes
Context: Majors General Biology, 150+ students, mixed preparation, high DFW rate, different fields (ex, pre-health), diverse socioeconomic and ethnic groups, students at a state university Prior Knowledge: Protein structure, Mendelian genetics, transcription, translation
3
Unit Learning Goals: Understand the link between gene and phenotype
Understand how a mutation in DNA affects the amino acid sequence Understand that a change in amino acid sequence can result in changes in protein function Develop science process skills
4
Teachable Tidbit Learning Outcomes:
A. Give examples of how genotypic changes can lead to phenotypic changes (1) B. Given a wild type and mutant amino acid and/or mRNA sequences, identify the type of mutation that occurred (2) C. Compare and contrast the effects of different mutations on the resulting amino acid sequence (4) D. Design an experiment to test how amino acid sequence affects protein function (5) E. Draw a concept map that illustrates the relationships between genes and phenotypes (5) F. Interpret graphical data about biological phenomenon (4)
5
Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver
Ryan Clark is a safety for the Pittsburgh Steelers, an elite athlete in top shape. he has one mutated copy of the hemoglobin gene, that hasn’t interfered with his health. However, in a 2007 during a game in Denver he became ill, due to his mutated gene. He later ended up and having to have his spleen and gallbladder removed. He sat out the 2007 season and resumed playing in 2008. However, he has sat out games played in Denver since his return. Image credit-
6
Video credit-http://dnalc
7
Q1: What is Ryan’s genotype. A. He is homozygous for the normal allele
Q1: What is Ryan’s genotype? A. He is homozygous for the normal allele. B. He is heterozygous. C. He is homozygous for the mutant allele. D. He is hemizygous. [reintroducing genetics vocab] Answer: B
8
Q2: Which of the following contributes to sickle cell disease in Ryan?
A. O2 levels B. Mutated DNA C. Abnormal protein D. All of the above E. Not enough information Clicker question – Prior knowledge about sickle cell
9
Video credit-http://dnalc
10
Let’s take a closer look at Ryan’s DNA!
GROUP ACTIVITY! Let’s take a closer look at Ryan’s DNA! Discuss before: Single point mutation that causes an amino acid substitution. Finish watching video to achieve this.
11
Let’s take a closer look at Ryan’s DNA!
GROUP ACTIVITY! Let’s take a closer look at Ryan’s DNA! Ryan’s normal allele 5’ … CTATGGTGCACCTGACTCCTGAGGAGAAGT … 3’ Ryan’s mutant allele 5’ … CTATGGTACACCTGACTCCTGTGGAGAAGT … 3’ Have students consider: What kind of mutation was on the worksheet? Silent, nonsense, missense/substitution mutation Let’s think about how these mutations might affect proteins differently.
12
nonsense early in sequence silent
Q3: Rank the following mutations (from low to high) with regards to the severity of their impacts on the final protein: nonsense early in sequence silent missense mutation of valine for alanine missense mutation of valine for lysine. A. 1, 2, 3, 4 B. 2, 3, 4, 1 C. 1, 2, 4, 3 D. 2, 3, 1, 4 E. 2, 4, 3, 1 Answer. B Carly: Not all missense mutations are bad. – Transition to Rich -
13
Back to Ryan… We know that not all mutations are bad but we know that Ryan has one bad copy. Now what does that mean for Ryan’s blood cells? [Straight into clicker question] Picture credit-
14
Q4: In each of Ryan’s red blood cells, what type of hemoglobin proteins are present? A. Normal and mutant hemoglobin B. Mutant hemoglobin C. Normal hemoglobin D. None since they lack nucleus E. It depends on oxygen levels Ryan has a dominant and mutant/recessive allele, what impact is that going to have on the proteins that they produce. After question, Ryan has this mutant protein in his blood. What kinds of treatments would be available to him? These people have a mutant protein that they make. This speaks well to the next activity on treatment.
15
Take-Home Activity For each treatment type, place an X in the box(s) that the treatment will resolve. Targets Treatment Type Ryan’s a really rich athlete and he wants you to cure him! Think about which treatments are better for homozygotes and heterozygotes? Weigh the risks and benefits of each treatment and for each individual? Upper division version would not include the treatment options.
16
Alignment and Assessment
See hand-out
17
Diversity Highlight role model from an under-represented group
Disease range vs. homework question Inequality in access to healthcare Pedagogical diversity: group work, think-pair-share, data interpretation, concept maps, visual-auditory We have addressed the diversity in levels of student prep by ensuring that all concepts and skills were developed/practiced/guided in the class itself.
18
Assessment examples – Clicker questions and exam questions (concept map and experiment)
19
Alignment Learning Objective Assessment Active learning Low Order/
High Order Diversity Diversity:
20
Think-Pair-Share How could this amino acid substitution change the shape of the protein and the cell? Protein Cell Image Source: Berkley’s “Understanding Evolution” Image Source:
21
Mutation Hemoglobin figure: public domain image
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.