Presentation is loading. Please wait.

Presentation is loading. Please wait.

B DAPIDNAmerge S P A CENP-A HDAC1 Aurora B C Centrifugation on 15% sucrose 200 g, 10 min Centrifugation on 30% sucrose 2500 g, 20 min Centrifugation on.

Similar presentations


Presentation on theme: "B DAPIDNAmerge S P A CENP-A HDAC1 Aurora B C Centrifugation on 15% sucrose 200 g, 10 min Centrifugation on 30% sucrose 2500 g, 20 min Centrifugation on."— Presentation transcript:

1 B DAPIDNAmerge S P A CENP-A HDAC1 Aurora B C Centrifugation on 15% sucrose 200 g, 10 min Centrifugation on 30% sucrose 2500 g, 20 min Centrifugation on 30% sucrose 27000 g, 30 min Elimination of unbroken nuclei Elimination of nucleoli Supernatant (S) = low density fraction Pellet (P) = chromocenters Nuclei + 2 mM TEA, 0.2 mM MgCl 2, 0.2% Triton Sonication Isolation of the chromocenters 200 400 100 bp SP -+-+ minsat E Sir2 Survivin SP Ferri et al. Supplemental Figure 1 SP minsat 200 100 400 600 bp 15 40 15 60 120 kDa D

2 minsat rDNA H3Ac H3K9Me3 CENP-A beads INPUT IPSUP H3Ac H3K9Me3 CENP-A beads Total DNAMarker 100bp majsat Ferri et al. Supplemental Figure 2 300 500 100 300 500 100 bp 300 100 200 300 100 400 600 1500 2000 bp

3 -+-+ ASNOC minsat  -actin AS 0400 0 100 200 600 G0/G1: 33% S: 57% G2/M: 10% NOC 0400 0 100 200 600 G0/G1: 2% S: 12% G2/M: 86% Ferri et al. Supplemental Figure 3 PI counts PI counts 200 300 400 500 bp

4 1: RNA 2’OMe (1-27) 5’biot-GGAAACAUGAUAAAAACCACAGUGUAG-3’ 2: DNA (1-27) 5’biot-GGAAACATGATAAAAACCACAGTGTAG-3’ 3: DNA/lna (4-27) 5’-aACaTGaTAaAAaCCaCAgTGtAG-3’biot 4: DNA/lna (89-115) 5’-tGTgTAtATcAAtGAgTTaCAaTG-3’biot 5: DNA/lna (4-27) 5’biot-aACaTGaTAaAAaCCaCAgTGtAG-3’ murine minor satellites 120 nt repeat unit consensus sequence : 5’GGAAACATGATAAAAACCACAGTGTAGAACATATTAGATGAGTGAGTTACACTGAAAA ACACATTCGTTGGAAACGGGATTTGTAGAACAGTGTATATCAATGAGTTACAATGAGAA ACAT-3’ Ferri et al. Supplemental Figure 4 input 12345 RNA minsat MEL nuclear extracts Streptavidin beads Biotinylated oligonucleotide In vitro transcribed RNA


Download ppt "B DAPIDNAmerge S P A CENP-A HDAC1 Aurora B C Centrifugation on 15% sucrose 200 g, 10 min Centrifugation on 30% sucrose 2500 g, 20 min Centrifugation on."

Similar presentations


Ads by Google