Presentation is loading. Please wait.

Presentation is loading. Please wait.

Multilocus Sequence Typing of bacteria: a genotypic tool for strain selection Aundy Kumar, *Jos M. Raaijmakers, Santhosh J Eapen Indian Institute of Spices.

Similar presentations


Presentation on theme: "Multilocus Sequence Typing of bacteria: a genotypic tool for strain selection Aundy Kumar, *Jos M. Raaijmakers, Santhosh J Eapen Indian Institute of Spices."— Presentation transcript:

1 Multilocus Sequence Typing of bacteria: a genotypic tool for strain selection Aundy Kumar, *Jos M. Raaijmakers, Santhosh J Eapen Indian Institute of Spices Research, Calicut ___________________________________________________________________ **Laboratory of Phytopathology, Wageningen University, The Netherlands Image courtesy: pseudomonas.com

2 Tools and web resources at your door step! Advances in sequencing methods Ever reducing cost of sequencing Freely available analytical tools Good databases with constant updates Full genome information on 1400 bacteria

3 Pseudomonas Acinetobacter Klebsiella Stenotrophomonas Enterobacter Bacillus Burkholderia MLST scheme has been developed for ~40 bacteria so far

4

5 What is MLST?  A nucleotide sequence based approach to uncover allelic variants in conserved genes (house keeping) for the purpose of characterizing, subtyping, and classifying members of bacterial populations.  Proposed in 1998 using the human pathogen Neisseria meningitidis as an example  A portable, universal, and definitive method for characterizing bacteria

6 MLST – genes used Pseudomonas aerugenosa acsAacetyl coenzyme A aroEShikimate dehydrogenase guaAGMP synthase mutLDNA mismatch repair protein nuoDNADH dehydrogenase I ppsAPhosphoenol pyruvate synthase trpEAnthralite synthetase

7 PCR amplification of selected genes Elution & purification of PCR product Sequencing of PCR product Sequence assembly (DNA Baser) Blast the assembled sequence in database Assigning allele numbers for each gene Unique allelic profile is called the Sequence Type(ST)

8 Each sequence for a given locus is screened for identity (not for similarity) with already known sequences for that locus. If the sequence is different, it is considered to be a new allele and is assigned a unique (arbitrary) allele number

9 Case study of Multilocus Sequence Typing of plant associated Pseudomonas aeruginosa of plant associated Pseudomonas aeruginosa

10 In Spice crops Projects on bacterial endophytes in black pepper/ginger against major soil borne pathogens …has yielded several diverse group of bacterial species The best among the lot is Pseudomonas aeruginosa Aravind et al Letters in Applied Microbiology, 2009

11 StrainSourceYear of collection Isolated by Pa-GEB9Ginger, Calicut (against Pythium) 2007Aundy Kumar Pa-IISR51Ginger, Karnataka (against Pythium) 1998Aundy Kumar Pa-BP35Black pepper, Kerala (against Phytophthora) 2006Aundy Kumar Pa-IISR13Black pepper, Andhra Pradesh (against Phytophthora) 1998Y.R.Sarma Pa-IISR6Black pepper, Kerala (against Phytophthora) 2000Y.R.Sarma Pa-IISR853Chromolaena odorata (against nematodes) 2005S.J.Eapen PAO1- Type strain Human burn patient, Australia1950sBruce Holloway Selected from several collection in various projects during different points Some of them are endophytes in plants

12 DNA of BP35 DNA extracted from bacterized stem is used as template 578bp Direct evidence for protection of black pepper by specific density of P. aeruginosa BP35 cells Phytophthora Suppression % BP35 Density in Suspension 8-10 log units Endogenous Population of BP log units Phenotype- functional

13 Leaf Roots Stem Localization of BP35::gfp2 in tomato Accumulation of bacterial cells Tracking of bacterium PaBP35 15 Days Post Bacterization in Five weeks old tomato cultivar, Moneymaker Tissues fixed in 4% paraformaldehyde Localized in aerial plant parts The bacterium was tagged with gpf using Tn7 system Phenotype- functional

14 Few of them are in field evaluation stage for 1.Phytophthora suppression 2.Radopholus similis suppression Single or Two nodal cutting are Bioprimed Bacterized shoots March 2010 July 2010 August 2010 Metalaxyl

15 Collectively they may be classified as Plant Associated Pseudomonas aeruginosa Pseudomonas aeruginosa- Type strain for Pseudomonas Most intensively studied bacterium Opportunistic human pathogen Full genome published in Nature

16 MLST analysis Analysis of housekeeping genes that are scattered in the genome

17 GeneAmplicon (bp) Position in the PAO1 genome Sequence for MLST analysis (bp) Coordinates in the PAO1 genome No of alleles documented so far acsA -(acetyl coenzyme A) aroE-(Shikimate dehydrogenase) guaA-(GMP synthase) mutL-(DNA mismatch repair protein) nuoD- (NADH dehydrogenase I) ppsA- (Phosphoenol pyruvate synthase) trpE- Anthralite synthetase Choice of genes for MLST analysis Genes were amplified using specific primers The amplicon were eluted using gel elution kit (Sigma Aldrich) Sequenced (Both forward and reverse run) M: DNA ladder 50bp aroE acsA guaA mutL nuoD ppsA trpE

18 BP35 PAO1 acsAaroE guaAmutL nuoD ppsA trpE acsAaroE guaAmutL nuoD ppsA trpE 1000bp Out group from clinical origin Gene amplification, isolation, sequencing and sequence analysis

19 aroE acsA guaA mutL nuoD ppsA trpE aroE acsA guaA mutL nuoD ppsA trpE BP35 IISR 853 GEB 9 aroE acsA guaA mutL nuoD ppsA trpE aroE acsA guaA mutL nuoD ppsA trpE aroE acsA guaA mutL nuoD ppsA trpE aroE acsA guaA mutL nuoD ppsA trpE IISR 6IISR 51IISR 13 All seven genes were isolated, sequenced and analysed

20 The sequences were assembled and analysed using Vector NTi Sequence viewer/ DNA baser

21 Alleles were determined using pubmlst.org String of alleles (Sequence Type) were analysed using eBurst algorithm (eBurst V3) or profuse algorithm (goeBurst.org)

22 >acsA-IISR6 TATAACTGTNGGNTTNAACGCGCTGACCCACGAGCGGGTCTT CGACTACCGTCCGGGCGAAGTCTACTGGTGCACCCGCCGGA CATCGGCTGGGTCACCGGCCACACCTACATCGTCTATGGCCC GCTGGCCAACGGCGCCACCACCATTCTGTTCGAGGGCGTGCC GAACTACCCCGACGTGACCCGCGTGGCGAAAATCATCGACA AGCACAAGGTCAACATCCTCTACACCGCGCCGACCGCGATC CGCGCGATGATGGCCGAAGGCAAGGCGGCGGTGGCCGGTG CCGACGGTTCCAGCCTGCGTCTGCTCGGTTCGGTGGGCGAGC CGATCAACCCGGAAGCCTGGCAGTGGTACTACGAGACCGTC GGCCAGTCGCGCTGCCCGATCGTCGACACCTGGTGGCAGAC CGAGACCGGCGCCTGCCTGATGACCCCGCTGCCGGGCGCCC ACGCGATGAAGCCGGGCTCTGCAGCCAAGCCGTTCTTCGGC GTGGTACCGGCGCTGGTGGACAACCTCGGCAACCTGATCGA GGGCGCCGCCGAGGGCAACCTGGTGATCCTCGACTCCTGGC CGGGCCAGGCGCGGACCCTGTTCGGCGACCATGACCGCTTC GTCGACACCTACTTCAAGACCTTCAAGGGCATGTACTTCACC GGCGACGGCGCGCGCCGCGACGAGGACGGCTACTACTGGA TCACCGGGCGGGTCGACGACGTGCTCAACGTCTCCGGCCAC CGCATGGGCACCGCCGAGGTGGAAAGCGCGATGGTCGCCC ACCCGAAGGTCGCCGAGGCGGCGGTGGTCGGCATGCAGCA CGACATCAAGGGGAGCG Allele: 15 >aroE-IISR6 CATGTCAGATGGAAACCGATTGAGACGTACGTCTCAAATGC TGCCTGACAACTCAGACAGTTGCCAATTGCCGGCGCAGCGTC TCCAACACTGGCGCCGAGGCAGGACGCACGCCACGCCAGA GGAAGAATGCCTCGGCGGCCTGCTCCACCAGCATGCCCAGG CCATCCAGGGTACGCGCCGCACCGCGTTCGGCGGCCCAGCG GTTGAAGGCGGTCGGTTCCTTGGCATACATCATGTCGTAGCA AACGGTACGGCCGGGCTCGATCACGCTCTGCGCCAGCGGCG GCACGTCGCCGGCAAGACTGGCCGAGGTGCCGTTGACGACC AGGTCGAAAGGCCCTTCGACCTCGGCGAAACCGCAGCCGC GCACCGCGCCGAGATCGGCGAACCGCTCGGCCAGATCCACG GCCTTCCGCGCCGTGCGGTTGGCGATCAGCAGCTCCGCCGGG CACTCGCCGAGGAAGGGTTCGAGCACCCCGCGCACCGCACC GCCGGCGCCGAGCAGGAGAACCCGCTTGCCGCGCAGCTCG ACCCCGGCGTTCGCCGTCAGGTCCCGCAGCAAGCCCGCGCC GTCGGTGTTGTCGCCGCGCAGGCGACCGTCGGCCAGGCGGA TGAGGGTGTTCACCGCCCCGGCCCGGGTGGCCCGCTCGCTCA ATTCGTCCACCAGACGATAGGCCTCTTCCTTGAACGGCACGG TGACATTGGCGCCCTTGCCCTGCTCGAAGAAGCGCCGGGCG AACCCGGGGAAATCGTCCAGCGGCGCCAGCTGCGCGTCATA GACCAGCGCCTCGCCGGTCTGCTCGGCGAACAGGCGGTGGA TCAGCGGCGACTTGCTGTGGCCGATGGGGTTGCCGAATACG CAATAGCGGTCCATGGGTCGTTCCTTTGCCGGGGTGGGACGG GACGAGCGGACTCGTCCCCTGCGGGCGGGTCAGGGCTGGCC GGCCAGCCAATCGCGGGTCGGCGAGGAAATACTCGGTCAG GCGCGCTTCCTCGCTGC Allele: 121 >guaA-IISR6 ANTNGNGGNCGNAACCNAANGNTGCCGCGGCCTGNCTTGG TGTTGGGTGACTTCCGGGGGGAATTCCAGCCGTTGNTGGCGC GGGAATTCGTNCCTTNAAGCGGTGGTGAGCCACGGCGACA AGGTCACCGAGATGCCGGCCGCGCTTCCACATCCTGGCCAG CACCCCGAGCTGCCCGATCGCCGCCATGGCAGACGATGCCC GCGCCTACTACGGCGTGCAATTCCACCCGGAAGTCACCCAC ACCAAGCAGGGCCTGCGCATTCTCTCGCGCTTCGTCCTCGAC ATCTGCGGTTGCGCCGCGCTGTGGACCCCCTCGAACATCGTC GACGACGCCATCGCCACCGTGCGCGCCCAGGTCGGTTCCTCC AAGGTCCTGCTAGGCCTCTCCGGCGGCGTGGACTCCTCGGTG GTCGCCGCGCTGCTGCACAAGGCCATCGGCGACCAACTGAC CTGCGTGTTCGTCGACAACGGCCTGCTGCGCCTGCACGAAGG CGACCAGGTGATGGCCATGTTCGCCGAGAACATGGGCGTGA AGGTGATCCGCGCCAACGCCGAGGACAAGTTCCTCGGCCGC CTGGCCGGCGTCGCCGACCCGGAAGAGAAGCGCAAGATCA TCGGCCGCACCTTCATCGAAGTCTTCGACGAAGAAGCCACC AAGCTGCAGGACGTGAAGTTCCTCGCCCAGGGCACCATCTA CCCCGACGTGATCGAGTCGGCCGGCGCCAAGACCGGCAAG GCCCACGTGATCAAGTCGCACCACAACGTCGGCGGCCTGCC GGAGGACATGCAGTTCGAACTGGTCGAGCCGCTGCGCGAA CTGTTCAAGGACGAAGTGCGCAAGATCGGCCTGGAGCTGG GCCTGCCCTACGACATGGTCTACCGCCACCCGTTCCCCGGCCC GGGCCTGGGCGTGCGCATCCTCGGCGAGGTGAAGAAAGAG TACGCCGACCTGCTGCGCCAGGCCGACCACATCTTCATCGAG GAACTGCGCGCCTTCGACTGTACCACAGACAGCCCGGGCGG TTCGATACANTGCNNCGCCTACNACGGCNGGCAATTCCGCC CNGAAGTCACTCACACAAGCANNNNGGCCANNCTCTGCCN GTTCCN Allele: 36 >mutL-IISR6 GGCGGTCGCGAGTCATGGTNGCGCGNACCGAACTAATCGA GCCAGCGCTCGCCACGGAGCCGNGGCTCATCCACCCGCCTTC AGAGANATGCGTCGCGTGAGTGGTCGAGCGTCCCGCCTCGG TGGCCAAGGAACTCTGGAAAACAGCTTGACGCCGGTTCCCG GGCGCATTGATGTGGAGGTCGAGCAGGGCGGCATCAAGTT GCTGCGAGTGCGCGACGACGGTCGCGGCATCCCCGCCGACG ACCTGCCGCTGGCCCTGGCTCGCCACGCCACCAGCAAGATCC GCGAGCTGGAAGACCTGGAGCGGGTGATGAGCCTCGGCTTC CGTGGCGAGGCGCTGGCCTCGATCAGTTCGGTAGCGCGCCT GACCATGACCTCGCGTACCGCCGACGCCGGCGAAGCCTGGC AGGTGGAAACCGAGGGCCGTGACATGCAGCCGCGGGTACA GCCGGCGGCGCACCCGGTGGGGACCAGCGTCGAGGTTCGC GACCTGTTCTTCAACACCCCGGCGCGGCGCAAGTTCCTGCGC GCCGAGAAGACCGAGTTCGACCATCTGCAGGAAGTCATCA AGCGCCTGGCGCTGGCCCGTTTCGACGTGGCTTTCCACCTGCG CCACAACGGCAAGACCATCTTCGCCCTGCACGAGGCGCGAG ACGAGCTGGCCCGCGCGCGCCGGGTCGGCGCGGTGTGCGG CCAGGCATTCCTCGAGCAGGCGCTGCCGATCGAGGTCGAGC GCAACGGCCTGCACCTGTGGGGCTGGGTCGGCTTGCCGACCT TCTCCCGCAGCCAGCCGGACCTGCAGTACTTCTATGTGAACG GGCGCATGGTGCGCGACAAGCTGGTCGCCCACGCGGTGCGC CAGGCTTATCGCGACGTGCTGTACAACGGCCGGCATCCGAC CTTCGTGCTGTTCTTCGAAGTCGATCCGGCGGTTGGTGGACGT CANNTGCACCCGAACNGCACGAGTTCGCTTNNNGACAGCC GGATGNCCATGACCTTCCCTCTNNNGAGANACCCNNNGA >nuoD-IISR6 NTNNNGCCCACGCCAACTGGTACGAGCGCGAAGTGTGGGA CATGTACGGCATCACCTTTCACCGGCCACCCGCACCTGACCC GCATGCTGATGCCGCCGACCTGGCAGGGCCATCCGCTGCGC AAGGACTACCCGGCGCGCGCCACCGAGTTCGATCCCTACTCC CTGTCCGCCGCCAAGCAGGACCTGGAGCAGGAAGCCCTGC GCTTCAAGCCGGAAGACTGGGGCATGAAGCGCCACGGCGA GAACGAGGACTACATGTTCCTCAACCTCGGCCCGAACCACC CGTCCGCCCACGGCGCGTTCCGCATCATCCTGCAACTGGACG GCGAGGAGATCATCGACTGCGTCCCGGAGATCGGCTACCAC CACCGCGGCGCCGAGAAGATGGCCGAGCGCCAGTCCTGGC ACAGTTTCATCCCCTACACCGACCGCATCGACTACCTCGGCG GGGTGATGAACAACCTGCCCTACGTACTCTCGGTGGAGAAG CTCGCCGGGATCAAGGTGCCCCAGCGGGTCGACGTGATCCG GATCATGATGGCGGAGTTCTTCCGTATCCTGAACCACCTGCTG TACCTGGGCACCTATATCCAGGACGTCGGCGCCATGACCCCG GTGTTCTTCACCTTCACCGACCGCCAGCGCGCCTACAAGGTG GTCGAGGCCATCACCGGCTTCCGCCTGCACCCGGCCTGGTAC CGCATCGGCGGCGTCGCCCACGACCTGCCGCGCGGCTGGGA CAAGCTGGTCCGCGAGTTCCTCGACTGGATGCCCAAGCGCCT CGACGAGTACGAGACCGCGGCCCTGAAGAACAGCATCTTG CGCGGCCGGACCATCGGCGTCGCCCAGTACAACACCAAGG AAGCCCTCGAGTGGGGCACCACCGGCGCCGGCCTGCGCGCC ACCGGTTGCGACTTCGACCTGCGCAAGGCCCGCCCCTACTCC GGCTACGAGAACTTCGAGTTCGAGGTACCGCTGGCCCACAA CGGCGACGCCTACGACCGCTGCATGGT Allele: 4 >ppsA-IISR6 AGATGCTTANGGAGCATAAGCTNTNGNAATCCTGGNNNCCC AANCCTCCTCCCTTCTATTNNNNGACGTCGATCGTNCGATCGC GCCNNTCGCCTGAGCGACGCCGAGGTCACCGAAGCTGGCC AAGCAGGCCATGATCATCGAGAAGCACTATGGCCGCCCGAT GGACATCGAATGGGCCAAGGACGGTGACGACGGCAAGCT GTACATCGTCCAGGCACGCCCGGAAACCGTGAAGAGCCGC GCCAGCGCCACGGTCATGGAGCGCTACCTGCTGAAAGAGA AGGGGACCGTCCTGGTGGAAGGGCGTGCCATCGGCCAGCG CATCGGTGCCGGTCCGGTCAAGGTGATCAACGACGTGTCGG AAATGGACAAGGTCCAACCGGGTGACGTCCTGGTCTCCGAC ATGACCGACCCGGACTGGGAGCCAGTGATGAAGCGCGCCA GCGCCATCGTCACCAACCGCGGCGGGCGCACCTGCCACGCG GCGATCATCGCTCGCGAACTGGGCATCCCGGCGGTGGTCGG TTGCGGCAACGCCACCCAGATCCTGCAGGATGGCCAGGGG GTGACCGTTTCCTGTGCCGAAGGCGATACCGGCTTCATCTTCG AAGGCGAACTCGGTTTCGATGTGCGCAAGAACTCGGTCGAC GCCATGCCCGACCTTCCGTTCAAGATCATGATGAACGTCGGC AATCCCGATCGCGCTTTCGATTTCGCCCAGTTGCCGAACGAA GGCGTGGGCCTGGCCCGCCTCGAATTCATCATCAACCGCATG ATCGGCGTGCATCCCAAGGCGTTGCTGAACTTCGCCGGCCTG CCGGCGGACATCAAGGAAAGCGTGGAGAAGCGCATCGCC GGCTATCCCGATCCGGTCGGCTTCTACGTCGAGAAGCTGGTG GAGGGCATCAGCACCCTGGCCGCGGCGTTCTGGCCGAAGA ACGGTCATCGTGCGCCTGTCCGACTTCAAGTCCAATGAGTAC GCCACCTGATCGGCGGCAGCTCTACGAGCAGGAGAAACAT AACNCTCCACCAATGAANANANNGACNANN Allele: 15 >trpE-IISR6 ATCNNNTATTCAAGNCTCAATCGTTCAAGNACGATCCAGCN ACAGCGNNNNNNGCNNNGCTTCCNCCTAATCNCGNNAAAT NNGNNNNGCGCCNNCAGCNGNNNNGGCGCGNGCACGGCT GAAGGCAATGAACGCATGCATCGATCGCGTATCAAACGTA ACTGCACTGCATGCGGGGGCGGATCGTGCCACCTCCGTCCCG GCGGCTTGTGATGGTTTCTTCCCACTCCAGCGCCGGCACCGA GTCGGCAACGATACCGCCGCCGGCCTGCACGTGGAGTTCAC CGTTCTTGATCACCGCGGTGCGGATGGCAATGGCGGTGTCCA TGTTGCCGTTCCATGCCAGGTAGCCGACCGCGCCGCCGTAGA CTCCACGCTTGACCGGCTCCAGCTCGTCGATGATCTCCATGGC GCGGATCTTCGGCGCGCCGGACAGCGTACCCGCCGGCAGG ATCGCCCGCAGCGCGTCCATCGCGCTGAGCCCCTCGCGCAAT TGCCCGGTGACGTTGGACACGATGTGCATGACGTTGGAGTA ACGTTCGATCACCATTTTTTCGGTGACCTTCACCGCGCCGATAT CGGACACCCGCCCCACGTCGTTGCGCCCCAGGTCGATCAGCA TCAGGTGCTCGGCGATCTCCTTGGCGTCCGACAGCAGATCCT GCTCCAGCGCCAGGTCGGCCTCTTCGTTGATCCCGCGCGGAC GGGTACCGGCGATCGGGCGCACCGTCACCAGGCCATCCTCG ACCCGTACCAGCACCTCCGGCGAGCTGCCCACGACATGGAA GTCGCCGAAGTTGAAGAAGTACATGTAGGGCGTCGGATTG AAACAGCGCAGCGCGCGGTACAGGTCGATGGGCGCCGCCT TGAATTCGATGGACATGCGCTGCGACGGCACCACCTGCATG CAGTCGCCGGCCAGGATGTAGTCCTTGATCCTTCCTACCGCGT CTTCATAGTCCTCGCGGGTGAAGCTGGCACGAAACGCCAGC TCACGCCTTGGGGNCCCGCACANAGTGGGGGCGGGTGCCCC ATCTGCGTGCCGTGAAGTTCACCGTTATAGATGANCGNTGTA CGGATAGTCNTAGCTGTNTCATGTTGCCTTCAATGTCACGTGC AATCGCGCGCGTAGACCNCTCGACGGACGCCTCTCATGATAT CCTGGCGGCAGTACGCTGCGCAGCGCANNGNAAGTNGNNN CATGGCTNGCCTCGGCAATGTCGGATCAG Allele: 8 P. aeruginosa IISR6 Allele: 5

23 >acsA-IISR51 CNNCAGGGGTTCTTGANTACCGTCCGGGCGAGTCTACTGGTG CACCGCCGACATCGGCTGGGTCACCGGCCACACCTACATCGT CTATGGCCCGCTGGCCAACGGCGCCACCACCATTCTGTTCGA GGGCGTGCCGAACTACCCCGACGTGACCCGCGTGGCGAAA ATCATCGACAAGCACAAGGTCAACATCCTCTACACCGCGCC GACCGCGATCCGCGCGATGATGGCCGAAGGCAAGGCGGCG GTGGCCGGTGCCGACGGTTCCAGCCTGCGTCTGCTCGGTTCG GTGGGCGAGCCGATCAACCCGGAAGCCTGGCAGTGGTACT ACGAGACCGTCGGCCAGTCGCGCTGCCCGATCGTCGACACC TGGTGGCACACCGAGACCGGCGCCTGCCTGATGACCCCGCT GCCGGGCGCCCACGCGATGAAGCCGGGCTCTGCAGCCAAG CCGTTCTTCGGCGTGGTACCGGCGCTGGTGGACAACCTCGGC AACCTGATCGAGGGCGCCGCCGAGGGCAACCTGGTGATCCT CGACTCCTGGCCGGGCCAGGCGCGGACCCTGTTCGGCGACC ATGACCGCTTCGTCGACACCTACTTCAAGACCTTCAAGGGCA TGTACTTCACCGGCGACGGCGCGCGCCGCGACGAGGACGG CTACTACTGGATCACCGGGCGGGTCGACGACGTGCTCAACG TCTCCGGCCACCGCATGGGCACCGCCGAGGTGGAAAGCGC GATGGTCGCCCACCCGAAGGTCGCCGAGGCGGCGGTGGTC GGCATGCAGCACGACATCAAGGGGCAGCA Allele: 15 >aroE-IISR51 TGNNTTNGNGGACGGATTTTGAGACGTACGTCTCAAATGCT GCCTGACAACTCAGACAGTTGCCAATTGCCGGCGCAGCGTCT CCAACACTGGCGCCGAGGCAGGACGCACGCCACGCCAGAG GAAGAATGCCTCGGCGGCCTGCTCCACCAGCATGCCCAGGC CATCCAGGGTACGCGCCGCACCGCGTTCGGCGGCCCAGCGG TTGAAGGCGGTCGGTTCCTTGGCATACATCATGTCGTAGCAA ACGGTACGGCCGGGCTCGATCACGCTCTGCGCCAGCGGCGG CACGTCGCCGGCAAGACTGGCCGAGGTGCCGTTGACGACCA GGTCGAAAGGCCCTTCGACCTCGGCGAAACCGCAGCCGCGC ACCGCGCCGAGATCGGCGAACCGCTCGGCCAGATCCACGGC CTTCCGCGCCGTGCGGTTGGCGATCAGCAGCTCCGCCGGGCA CTCGCCGAGGAAGGGTTCGAGCACCCCGCGCACCGCACCGC CGGCGCCGAGCAGGAGAACCCGCTTGCCGCGCAGCTCGACC CCGGCGTTCGCCGTCAGGTCCCGCAGCAAGCCCGCGCCGTCG GTGTTGTCGCCGCGCAGGCGACCGTCGGCCAGGCGGATGAG GGTGTTCACCGCCCCGGCCCGGGTGGCCCGCTCGCTCAATTC GTCCACCAGACGATAGGCCTCTTCCTTGAACGGCACGGTGAC ATTGGCGCCCTTGCCCTGCTCGAAGAAGCGCCGGGCGAACC CGGGGAAATCGTCCAGCGGCGCCAGCTGCGCGTCATAGACC AGCGCCTCGCCGGTCTGCTCGGCGAACAGGCGGTGGATCAG CGGCGACTTGCTGTGGCCGATGGGGTTGCCGAATACGCAAT AGCGGTCCATGGGTCGTTCCTTTGCCGGGGTGGGACGGGAC GAGCGGACTCGTCCCCTGCGGGCGGGTCAGGGCTGGCCGGC GAGCCAATCGCGGTCGGCGAGGAAATACTCGGTCAGGCGC GCTCCTCNNNNCCGGCC Allele: 121 >guaA-IISR51 NGGNNNNNANACCCCANNGACTNNNNGGCCCTGCTGGTGT GGGTGACTCCGGGGGGGAATTTCAGCCGTGGTAGCCGCGG ATCTCTGTCTNCNCGANGAGTGTGATGAGCACGGCGACAAG GTCACCGAGATGCCGGCCGGCTTCCACATCCTGGCCAGCACC CCGAGCTGCCCGATCGCCGCCATGGCCGACGATGCCCGCGC CTACTACGGCGTGCAATTCCACCCGGAAGTCACCCACACCA AGCAGGGCCTGCGCATTCTCTCGCGCTTCGTCCTCGACATCTG CGGTTGCGCCGCGCTGTGGACCCCCTCGAACATCGTCGACGA CGCCATCGCCACCGTGCGCGCCCAGGTCGGTTCCTCCAAGGT CCTGCTAGGCCTCTCCGGCGGCGTGGACTCCTCGGTGGTCGC CGCGCTGCTGCACAAGGCCATCGGCGACCAACTGACCTGCG TGTTCGTCGACAACGGCCTGCTGCGCCTGCACGAAGGCGAC CAGGTGATGGCCATGTTCGCCGAGAACATGGGCGTGAAGGT GATCCGCGCCAACGCCGAGGACAAGTTCCTCGGCCGCCTGG CCGGCGTCGCCGACCCGGAAGAGAAGCGCAAGATCATCGG CCGCACCTTCATCGAAGTCTTCGACGAAGAAGCCACCAAGC TGCAGGACGTGAAGTTCCTCGCCCAGGGCACCATCTACCCCG ACGTGATCGAGTCGGCCGGCGCCAAGACCGGCAAGGCCCA CGTGATCAAGTCGCACCACAACGTCGGCGGCCTGCCGGAGG ACATGCAGTTCGAACTGGTCGAGCCGCTGCGCGAACTGTTCA AGGACGAAGTGCGCAAGATCGGCCTGGAGCTGGGCCTGCC CTACGACATGGTCTACCGCCACCCGTTCCCCGGCCCGGGCCT GGGCGTGCGCATCCTCGGCGAGGTGAAGAAGGAGTACGCC GACCTGCTGCGCCAGGCCGACCACATCTTCATCGAGGAACT GCGCGCCTTCGACTGGTACCACAGACAGCCCGGGGGCGTTC AGTTCNATGGCTCAAAGATCTAGTAACGGCTTGCAAATTCN GCCCGGGATANTCACNCCANTACCATGCCNNNAGGCGCATT CC Allele: 36 >mutL-IISR51 NCGAGGTCATGGTNNNCGCGCAACCGAANTATCGAGGCAA GCGACTTCGCCNACGAAGCCGAGGCTTCATCACCCGCTCCAT GNCNTCAATAGTCCCCCGCGTGAGTGTCGAGCGTCCCGCTCG GTGGCCAAGGAACTCTGGAAAACAGCTTGACGCCGGTTCCC GGCGCATTGATGTGGAGGTCGAGCAGGGCGGCATCAAGTT GCTGCGAGTGCGCGACGACGGTCGCGGCATCCCCGCCGACG ACCTGCCGCTGGCCCTGGCTCGCCACGCCACCAGCAAGATCC GCGAGCTGGAAGACCTGGAGCGGGTGATGAGCCTCGGCTTC CGTGGCGAGGCGCTGGCCTCGATCAGTTCGGTAGCGCGCCT GACCATGACCTCGCGTACCGCCGACGCCGGCGAAGCCTGGC AGGTGGAAACCGAGGGCCGTGACATGCAGCCGCGGGTACA GCCGGCGGCGCACCCGGTGGGGACCAGCGACGAGGTTCGC GACCTGTTCTTCAACACCCCGGCGCGGCGCAAGTTCCTGCGC GCCGAGAAGACCGAGTTCGACCATCTGCAGGAAGTCATCA AGCGCCTGGCGCTGGCCCGTTTCGACGTGGCTTTCCACCTGCG CCACAACGGCAAGACCATCTTCGCCCTGCACGAGGCGCGAG ACGAGCTGGCCCGCGCGCGCCGGGTCGGCGCGGTGTGCGG CCAGGCATTCCTCGAGCAGGCGCTGCCGATCGAGGTCGAGC GCAACGGCCTGCACCTGTGGGGCTGGGTCGGCTTGCCGACCT TCTCCCGCAGCCAGCCGGACCTGCAGTACTTCTATGTGAACG GGCGCATGGTGCGCGACAAGCTGGTCGCCCACGCGGTGCGC CAGGCTTATCGCGACGTGCTGTACAACGGCCGGCATCCGAC CTTCGTGCTGTTCTTCGAAGTCGATCCGGCGGTGGTGGACGTC AACGTGCACCCGACCAAGCACGAAGTTCGCTTCCGTGACAG CCGGATGGTCCATGACTTCCTCTANGGGGNCACCNGAA Allele: 5 >nuoD-IISR51 CCCCCGNTNGCCNACGCCACTGGTACGAGCGCGAAGTGTGG GACATGTACGGCATCACCTTCACCGGCCACCCGCACCTGACC CGCATGCTGATGCCGCCGACCTGGCAGGGCCATCCGCTGCG CAAGGACTACCCGGCGCGCGCCACCGAGTTCGATCCCTACTC CCTGTCCGCCGCCAAGCAGGACCTGGAGCAGGAAGCCCTGC GCTTCAAGCCGGAAGACTGGGGCATGAAGCGCCACGGCGA GAACGAGGACTACATGTTCCTCAACCTCGGCCCGAACCACC CGTCCGCCCACGGCGCGTTCCGCATCATCCTGCAACTGGACG GCGAGGAGATCATCGACTGCGTCCCGGAGATCGGCTACCAC CACCGCGGCGCCGAGAAGATGGCCGAGCGCCAGTCCTGGC ACAGTTTCATCCCCTACACCGACCGCATCGACTACCTCGGCG GGGTGATGAACAACCTGCCCTACGTACTCTCGGTGGAGAAG CTCGCCGGGATCAAGGTGCCCCAGCGGGTCGACGTGATCCG GATCATGATGGCGGAGTTCTTCCGTATCCTGAACCACCTGCTG TACCTGGGCACCTATATCCAGGACGTCGGCGCCATGACCCCG GTGTTCTTCACCTTCACCGACCGCCAGCGCGCCTACAAGGTG GTCGAGGCCATCACCGGCTTCCGCCTGCACCCGGCCTGGTAC CGCATCGGCGGCGTCGCCCACGACCTGCCGCGCGGCTGGGA CAAGCTGGTCCGCGAGTTCCTCGACTGGATGCCCAAGCGCCT CGACGAGTACGAGACCGCGGCCCTGAAGAACAGCATCTTG CGCGGCCGGACCATCGGCGTCGCCCAGTACAACACCAAGG AAGCCCTCGAGTGGGGCACCACCGGCGCCGGCCTGCGCGCC ACCGGTTGCGACTTCGACCTGCGCAAGGCCCGCCCCTACTCC CGGCTACGAGAACTTCGAGTTCGAGGTACCGCTGGCCCACA CGGCGACGCTACGACGCTGCNTNNNNNN Allele: 4 >ppsA-IISR51 NCGNCAAAATGNTTCTTGCNTATNNGNNNNTTTTGNGTGCTT CCTTNNGTATGTANGACGTCGATCGTGCCGATCGCGCCCGCT TCGCCTGAGCGACGCCGAGGTCACCGAGCTGGCCCAAGCA GGCCATGATCATCGAGAAGCACTATGGCCGCCCGATGGACA TCGAATGGGCCAAGGACGGTGACGACGGCAAGCTGTACAT CGTCCAGGCACGCCCGGAAACCGTGAAGAGCCGCGCCAGC GCCACGGTCATGGAGCGCTACCTGCTGAAAGAGAAGGGGA CCGTCCTGGTGGAAGGGCGTGCCATCGGCCAGCGCATCGGT GCCGGTCCGGTCAAGGTGATCAACGACGTGTCGGAAATGG ACAAGGTCCAACCGGGTGACGTCCTGGTCTCCGACATGACC GACCCGGACTGGGAGCCAGTGATGAAGCGCGCCAGCGCCA TCGTCACCAACCGCGGCGGGCGCACCTGCCACGCGGCGATC ATCGCTCGCGAACTGGGCATCCCGGCGGTGGTCGGTTGCGG CAACGCCACCCAGATCCTGCAGGATGGCCAGGGGGTGACC GTTTCCTGTGCCGAAGGCGATACCGGCTTCATCTTCGAAGGC GAACTCGGTCCCGATGTGCGCAAGAACTCGGTCGACGCCAT GCCCGACCTTCCGTTCAAGATCATGATGAACGTCGGCAATCC CGATCGCGCTTTCGATTTCGCCCAGTTGCCGAACGAAGGCGT GGGCCTGGCCCGCCTCGAATTCATCATCAACCGCATGATCGG CGTGCATCCCAAGGCGTTGCTGAACTTCGCCGGCCTGCCGGC GGACATCAAGGAAAGCGTGGAGAAGCGCATCGCCGGCTAT CCCGATCCGGTCGGCTTCTACGTCGAGAAGCTGGTGGAGGG CATCAGCACCCTGGCCGCGGCGTTCTGGCCGAAGAAGGTCA TCGTGCGCCTGTCCGACTTCAAGTCCAATGAGTACGCCACCT GATCGGCGCAAGCTCTACGAGCCGGAGAAAAGAGCAACA CCTNCNACCATTGNNNGCANNNCAANN Allele: 15 P. aeruginosa IISR51 >trpE-IISR51 GATACCGCCGCCGGCCTGCACGTGGAGTTCACCGTTCTTGAT CACCGCGGTGCGGATGGCAATGGCGGTGTCCATGTTGCCGTT CCATGCCAGGTAGCCGACCGCGCCGCCGTAGACTCCACGCTT GACCGGCTCCAGCTCGTCGATGATCTCCATGGCGCGGATCTT CGGCGCGCCGGACAGCGTACCCGCCGGCAGGATCGCCCGC AGCGCGTCCATCGCGCTGAGCCCCTCGCGCAATTGCCCGGTG ACGTTGGACACGATGTGCATGACGTTGGAGTAACGTTCGAT CACCATTTTTTCGGTGACCTTCACCGCGCCGATATCGGACACC CGCCCCACGTCGTTGCGCCCCAGGTCGATCAGCATCAGGTGC TCGGCGATCTCCTTGGCGTCCGACAGCAGATCCTGCTCCAGC GCCAGGTCGGCCTCTTCGTTGATCCCGCGCGGACGGGTACCG GCGATCGGGCGCACCGTCACCAGGCCATCCTCGACCCGTACC AGCACCTCCGGCGAGCTGCCCACGACATGGAAGTCGCCGA AGTTGAAGAAGTACATGTAGGGCGTCGGATTGAAACAGCG CAGCGCGCGGTACAGGTCGATGGGCGCCGCCTTGAATTCGA TGGACATGCGCTGCGACGGCACCACCTGCATGCAGTCGCCG GCCAGGATGTAGTCCTTGATCCTTCCTACCGCGTTTTCATAGTC CTCGCGGGTG Allele:8

24 > acsA-IISR13 TGCTATCACTCTNGGGTTTTATNGTCGCTGACCCACGAGCGG GTCTTCGACTACCGTCCGGGCGAAGTCTACTGGTGCACCGCC GACATCGGCTGGGTCACCGGCCACACCTACATCGTCTATGGC CCGCTGGCCAACGGCGCCACCACCATTCTGTTCGAGGGCGTG CCGAACTACCCCGACGTGACCCGCGTGGCGAAAATCATCGA CAAGCACAAGGTCAACATCCTCTACACCGCGCCGACCGCGA TCCGCGCGATGATGGCCGAAGGCAAGGCGGCGGTGGCCGG TGCCGACGGTTCCAGCCTGCGTCTGCTCGGTTCGGTGGGCGA GCCGATCAACCCGGAAGCCTGGCAGTGGTACTACGAGACC GTCGGCCAGTCGCGCTGCCCGATCGTCGACACCTGGTGGCA GACCGAGACCGGCGCCTGCCTGATGACCCCGCTGCCGGGCG CCCACGCGATGAAGCCGGGCTCTGCAGCCAAGCCGTTCTTCG GCGTGGTACCGGCGCTGGTGGACAACCTCGGCAACCTGATC GAGGGCGCCGCCGAGGGCAACCTGGTGATCCTCGACTCCTG GCCGGGCCAGGCGCGGACCCTGTTCGGCGACCATGACCGCT TCGTCGACACCTACTTCAAGACCTTCAAGGGCATGTACTTCAC CGGCGACGGCGCGCGCCGCGACGAGGACGGCTACTACTGG ATCACCGGGCGGGTCGACGACGTGCTCAACGTCTCCGGCCA CCGCATAAGCACCGCCGAGGTGGAAAGCGCGATGGTCGCC CACCCGAAGGTCGCCGAGGCGGCGGTGGTCGGCATGCAGC ACGACATCAAGGGGCACCCATTCTCTTTAGAGNGAGGGGG GCGTC Allele: 15 >aroE-IISR13 GGNTTNNNGGGACGGATTTGAGACGTACGTCTCAAATGCTG CCTGACAACTCAGACAGTTGCCAATCGCCGGCGCAGCGTCTC CAACACTGGCGCCGAGGCAGGACGCACGCCACGCCAGAGG AAGAATGCCTCGGCGGCCTGCTCCACCAGCATGCCCAGGCC ATCCAGGGTACGCGCCGCACCGCGTTCGGCGGCCCAGCGGT TGAAGGCGGTCGGTTCCTTGGCATACATCATGTCGTAGCAAA CGGTACGGCCGGGCTCGATCACGCTCTGCGCCAGCGGCGGC ACGTCGCCGGCAAGACTGGCCGAGGTGCCGTTGACGACCA GGTCGAAAGGCCCTTCGACCTCGGCGAAACCGCAGCCGCGC ACCGCGCCGAGATCGGCGAACCGCTCGGCCAGATCCACGGC CTTCCGCGCCGTGCGGTTGGCGATCAGCAGCTCCGCCGGGCA CTCGCCGAGGAAGGGTTCGAGCACCCCGCGCACCGCACCGC CGGCGCCGAGCAGGAGAACCCGCTTGCCGCGCAGCTCGACC CCGGCGTTCGCCGTCAGGTCCCGCAGCAAGCCCGCGCCGTCG GTGTTGTCGCCGCGCAGGCGACCGTCGGCCAGGCGGATGAG GGTGTTCAACGCCCCGGCCCGGGTGGCCCGCTCGCTCAATTC GTCCACCAGACGATAGGCCTCTTCCTTGAACGGCACGGTGAC ATTGGCGCCCTTGCCCTGCTCGAAGAAGCGCCGGGCGAACC CGGGGAAATCGTCCAGCGGCGCCAGCTGCGCGTCATAGACC AGCGCCTCGCCGGTCTGCTCGGCGAACAGGCGGTGGATCAG CGGCGACTTGCTGTGGCCGATGGGGTTGCCGAATACGCAAT AGCGGTCCATGGGTCGTTCCTTTGCCGGGGTGGGNAACGGG ACGAGCGAACTCGTCCCCTGGCGGGCGGGTCAGGGCTGGCC GGCGAGCCAATCGCGGTCGGCGAGGAAATACTCGGTCAGG CGCGCTCCCCGNNNCGGGCA Allele: 121 >mutL-IISR13 NGNNGCGGTACCAGAGGTCATGTCNGCGCGNACCAACNAT CNCGCCAGCGCCTCNCCANNANGCCGAGGCTCATCACCGCT TCTCAGNATCTTNGTCCGCGTGAGCTGTCGAGCGTCCCGCCTC GGTGGCCAAGGAACTCTGGAAAACAGCTTGACGCCGGTTCC CGGCGCATTGATGTGGAGGTCGAGCAGGGCGGCATCAAGTT GCTGCGAGTGCGCGACGACGGTCGCGGCATCCCCGCCGACG ACCTGCCGCTGGCCCTGGCTCGCCACGCCACCAGCAAGATCC GCGAGCTGGAAGACCTGGAGCGGGTGATGAGCCTCGGCTTC CGTGGCGAGGCGCTGGCCTCGATCAGTTCGGTAGCGCGCCT GACCATGACCTCGCGTACCGCCGACGCCGGCGAAGCCTGGC AGGTGGAAACCGAGGGCCGTGACATGCAGCCGCGGGTACA GCCGGCGGCGCACCCGGTGGGGACCAGCGTCGAGGTTCGC GACCTGTTCTTCAACACCCCGGCGCGGCGCAAGTTCCTGCGC GCCGAGAAGACCGAGTTCGACCATCTGCAGGAAGTCATCA AGCGCCTGGCGCTGGCCCGTTTCGACGTGGCTTTCCACCTGCG CCACAACGGCAAGACCATCTTCGCCCTGCACGAGGCGCGAG ACGAGCTGGCCCGCGCGCGCCGGGTCGGCGCGGTGTGCGG CCAGGCATTCCTCGAGCAGGCGCTGCCGATCGAGGTCGAGC GCAACGGCCTGCACCTGTGGGGCTGGGTCGGCTTGCCGACCT TCTCCCGCAGCCAGCCGGACCTGCAGTACTTCTATGTGAACG GGCGCATGGTGCGCGACAAGCTGGTCGCCCACGCGGTGCGC CAGGCTTATCGCGACGTGCTGTACAACGGCCGGCATCCGAC CTTCGTGCTGTTCTTCGAAGTCGATCCGGCGGTGGTGGACGTC AACGTGCACCCGACCAAGCACGAAGTTCGCTTCCGTGACAG CCGGATGGTCCATGACTTCCTCTAAGAGGAGACNCCTNNN Allele: 5 >mutL-IISR13 NGNNGCGGTACCAGAGGTCATGTCNGCGCGNACCAACNAT CNCGCCAGCGCCTCNCCANNANGCCGAGGCTCATCACCGCT TCTCAGNATCTTNGTCCGCGTGAGCTGTCGAGCGTCCCGCCTC GGTGGCCAAGGAACTCTGGAAAACAGCTTGACGCCGGTTCC CGGCGCATTGATGTGGAGGTCGAGCAGGGCGGCATCAAGTT GCTGCGAGTGCGCGACGACGGTCGCGGCATCCCCGCCGACG ACCTGCCGCTGGCCCTGGCTCGCCACGCCACCAGCAAGATCC GCGAGCTGGAAGACCTGGAGCGGGTGATGAGCCTCGGCTTC CGTGGCGAGGCGCTGGCCTCGATCAGTTCGGTAGCGCGCCT GACCATGACCTCGCGTACCGCCGACGCCGGCGAAGCCTGGC AGGTGGAAACCGAGGGCCGTGACATGCAGCCGCGGGTACA GCCGGCGGCGCACCCGGTGGGGACCAGCGTCGAGGTTCGC GACCTGTTCTTCAACACCCCGGCGCGGCGCAAGTTCCTGCGC GCCGAGAAGACCGAGTTCGACCATCTGCAGGAAGTCATCA AGCGCCTGGCGCTGGCCCGTTTCGACGTGGCTTTCCACCTGCG CCACAACGGCAAGACCATCTTCGCCCTGCACGAGGCGCGAG ACGAGCTGGCCCGCGCGCGCCGGGTCGGCGCGGTGTGCGG CCAGGCATTCCTCGAGCAGGCGCTGCCGATCGAGGTCGAGC GCAACGGCCTGCACCTGTGGGGCTGGGTCGGCTTGCCGACCT TCTCCCGCAGCCAGCCGGACCTGCAGTACTTCTATGTGAACG GGCGCATGGTGCGCGACAAGCTGGTCGCCCACGCGGTGCGC CAGGCTTATCGCGACGTGCTGTACAACGGCCGGCATCCGAC CTTCGTGCTGTTCTTCGAAGTCGATCCGGCGGTGGTGGACGTC AACGTGCACCCGACCAAGCACGAAGTTCGCTTCCGTGACAG CCGGATGGTCCATGACTTCCTCTAAGAGGAGACNCCTNNN Allele: 5 >nuoD-IISR13 NANTGCCCACGCACTGGTACGAGCGCGAAGTGTGGGACAT GTACGGCATCACCTTCACCGGCCACCCGCACCTGACCCGCAT GCTGATGCCGCCGACCTGGCAGGGCCATCCGCTGCGCAAGG ACTACCCGGCGCGCGCCACCGAGTTCGATCCCTACTCCCTGTC CGCCGCCAAGCAGGACCTGGAGCAGGAAGCCCTGCGCTTC AAGCCGGAAGACTGGGGCATGAAGCGCCACGGCGAGAAC GAGGACTACATGTTCCTCAACCTCGGCCCGAACCACCCGTCC GCCCACGGCGCGTTCCGCATCATCCTGCAACTGGACGGCGA GGAGATCATCGACTGCGTCCCGGAGATCGGCTACCACCACC GCGGCGCCGAGAAGATGGCCGAGCGCCAGTCCTGGCACAG TTTCATCCCCTACACCGACCGCATCGACTACCTCGGCGGGGT GATGAACAACCTGCCCTACGTACTCTCGGTGGAGAAGCTCG CCGGGATCAAGGTGCCCCAGCGGGTCGACGTGATCCGGATC ATGATGGCGGAGTTCTTCCGTATCCTGAACCACCTGCTGTACC TGGGCACCTATATCCAGGACGTCGGCGCCATGACCCCGGTGT TCTTCACCTTCACCGACCGCCAGCGCGCCTACAAGGTGGTCG AGGCCATCACCGGCTTCCGCCTGCACCCGGCCTGGTACCGCA TCGGCGGCGTCGCCCACGACCTGCCGCGCGGCTGGGACAAG CTGGTCCGCGAGTTCCTCGACTGGATGCCCAAGCGCCTCGAC GAGTACGAGACCGCGGCCCTGAAGAACAGCATCTTGCGCG GCCGGACCATCGGCGTCGCCCAGTACAACACCAAGGAAGC CCTCGAGTGGGGCACCACCGGCGCCGGCCTGCGCGCCACCG GTTGCGACTTCGACCTGCGCAAGGCCCGCCCCTACTCCGGCT ACGAGAACTTCGAGTTCGAGGTACCGCTGGCCCACACGGCG ACGCTACGACGCTGCANNNNGAAN Allele: 4 >ppsA-IISR13 NTCGAGGGCCATATNCNNTCGATGATCTTGCCTNCTNNGGTC GCNNNNTNNCAGTAGTGACGTCGATCGTGCCGATCGCGCCG CTTCGCCCTGAGCGACGCCGAGGTCACCGAGCTGGCCAAGC AGGCCATGATCATCGAGAAGCACTATGGCCGCCCGATGGAC ATCGAATGGGCCAAGGACGGTGACGACGGCAAGCTGTACA TCGTCCAGGCACGCCCGGAAACCGTGAAGAGCCGCGCCAG CGCCACGGTCATGGAGCGCTACCTGCTGAAAGAGAAGGGG ACCGTCCTGGTGGAAGGGCGTGCCATCGGCCAGCGCATCGG TGCCGGTCCGGTCAAGGTGATCAACGACGTGTCGGAAATGG ACAAGGTCCAACCGGGTGACGTCCTGGTCTCCGACATGACC GACCCGGACTGGGAGCCAGTGATGAAGCGCGCCAGCGCCA TCGTCACCAACCGCGGCGGGCGCACCTGCCACGCGGCGATC ATCGCTCGCGAACTGGGCATCCCGGCGGTGGTCGGTTGCGG CAACGCCACCCAGATCCTGCAGGATGGCCAGGGGGTGACC GTTTCCTGTGCCGAAGGCGATACCGGCTTCATCTTCGAAGGC GAACTCGGTTTCGATGTGCGCAAGAACTCGGTCGACGCCAT GCCCGACCTTCCGTTCAAGATCATGATGAACGTCGGCAATCC CGATCGCGCTTTCGATTTCGCCCAGTTGCCGAACGAAGGCGT GGGCCTGGCCCGCCTCGAATTCATCATCAACCGCATGATCGG CGTGCATCCCAAGGCGTTGCTGAACTTCGCCGGCCTGCCGGC GGACATCAAGGAAAGCGTGGAGAAGCGCATCGCCGGCTAT CCCGATCCGGTCGGCTTCTACGTCGAGAAGCTGGTGGAGGG CATCAGCACCCTGGCCGCGGCGTTCTGGCCGAAGAAGGTCA TCGTGCGCCTGTCCGACTTCAAGTCCAATGAGTACGCCAACC TGATCGGCGCAAGCTCTACGAGCCTGAGNNNNTACCTNNAC CATNNCGCAGCNACCANNANNNNTTNGCAGAAAGG ppsA: 15 >trpE-IISR13 GGGGGGNGGNTNTCGCTTACCGCGAGGACTATGAAACGCG GTAGGAAGGATCAAGGACTACATCCTGGCCGGCGACTGCAT GCAGGTGGTGCCGTCGCAGCGCATGTCCATCGAATTCAAGG CGGCGCCCATCGACCTGTACCGCGCGCTGCGCTGTTTCAATCC GACGCCCTACATGTACTTCTTCAACTTCGGCGACTTCCATGTC GTGGGCAGCTCGCCGGAGGTGCTGGTACGGGTCGAGGATG GCCTGGTGACGGTGCGCCCGATCGCCGGTACCCGTCCGCGC GGGATCAACGAAGAGGCCGACCTGGCGCTGGAGCAGGATC TGCTGTCGGACGCCAAGGAGATCGCCGAGCACCTGATGCTG ATCGACCTGGGGCGCAACGACGTGGGGCGGGTGTCCGATAT CGGCGCGGTGAAGGTCACCGAAAAAATGGTGATCGAACGT TACTCCAACGTCATGCACATCGTGTCCAACGTCACCGGGCAA TTGCGCGAGGGGCTCAGCGCGATGGACGCGCTGCGGGCGA TCCTGCCGGCGGGTACGCTGTCCGGCGCGCCGAAGATCCGC GCCATGGAGATCATCGACGAGCTGGAGCCGGTCAAGCGTG GAGTCTACGGCGGCGCGGTCGGCTACCTGGCATGGAACGGC AACATGGACACCGCCATTGCCATCCGCACCGCGGTGATCAA GAACGGTGAACTCCACGTGCAGGCCGGCGGCGGTATCGTTG CCGACTCGGTGCCGGCGCTGGAGTGGGAAGAACCATCAAC AGGCGCCGGACCGAGTCGGCACGATCCGCCACAGCTGCAG TGGAGTTCACGGTTTGATCACGGCGTGCGAGGCATGCGTTCA TGTGGCTTTCAGCGGTAGCACGCGCCNAAANNCGCTGGACG GCGCGCGNCNTAATTCNGGCGGNAAATTACGCGCCGNNNN GNC Allele: 8 P. aeruginosa IISR13

25 >acsA-IISR853 TATTCTGGTGTTTCGCCTCGCTGACCCACGAGCGGGTCTTCGA CTACCGTCCGGGCGAAGTCTACTGGTGCACCGCCGACATCG GCTGGGTCACCGGCCACACCTACATCGTCTATGGCCCGCTGG CCAACGGCGCCACCACCATTCTGTTCGAGGGCGTGCCGAACT ACCCCGACGTGACCCGCGTGGCGAAAATCATCGACAAGCA CAAGGTCAACATCCTCTACACCGCGCCGACCGCGATCCGCGC GATGATGGCCGAAGGCAAGGCGGCGGTGGCCGGTGCCGAC GGTTCCAGCCTGCGTCTGCTCGGTTCGGTGGGCGAGCCGATC AACCCGGAAGCCTGGCAGTGGTACTACGAGACCGTCGGCC AGTCGCGCTGCCCGATCGTCGACACCTGGTGGCAGACCGAG ACCGGCGCCTGCCTGATGACCCCGCTGCCGGGCGCCCACGC GATGAAGCCGGGCTCCGCGGCCAAGCCGTTCTTCGGCGTGG TACCGGCACTGGTGGACAATCTCGGCAACCTGATCGAGGGC GCCGCCGAGGGCAACCTGGTGATCCTCGACTCCTGGCCGGG CCAGGCGCGGACCCTGTTCGGCGACCATGACCGCTTCGTCGA CACCTACTTCAAGACCTTCAAGGGCATGTACTTCACCGGCGA CGGCGCGCGCCGCGACGAGGACGGCTACTACTGGATCACC GGGCGGGTCGACGACGTGCTCAACGTCTCCGGCCACCGCAT GGGCACCGCCGAGGTGGAAAGCGCGATGGTCCGCCCACCC CGAAGGTCGCCGAGGCGGCGGTGGTCGGCATGCAGCACGA CATCAAGGAGGGGATTTTTTTTTTNATAAGCCNCCCTGTTAGC CNGGTAACTTNGGTGGGGCACATGGTTCACTNGTCGTCCAGC CGTGGCGGAGACTTCAGAGTCTCACCGCGTGATCTTTNTAGC CNCNCTNCGCGNCNCCGNTCAATCANGTCNNGANGTTTGAN NNAGTTTCGACAAAACGCTTAGNATGCCTACAGGGACCNN N Allele: 22 >aroE-IISR853 GGAGAGGGTAAANCCATTTTGAGACGTACGTCTCAAATGCC GCCTGACAACTCAGACAGTTGCCAACTGTCGGCGCAGCGTCT CCAACACTGGCGCCGAGGCAGGACGCACGCCGCGCCAGAG GAAGAATGCCTCGGCGGCCTGCTCCACCAGCATGCCCAGGC CATCCAGGGTACGCGCCGCACCGCGTTCGGCGGCCCAGCGG TTGAAGGCAGTCGGTTCCTTGGCATACATCATGTCGTAGCAG ACGGTACGGCCGGGCTCGATCACGCTCTGCGCCAGCGGCGG CACGTCGCCGGCAAGACTGGCCGAGGTGCCGTTGACGATCA GGTCGAAAGGCCCTTCGACCTCGGCGAAACCGCAGCCGTGC ACCGCGCCGAGGTCGGCGAACCGCTCGGCCAGGTCCACGGC CTTCCGCGCCGTGCGGTTGGCGATCAGCAACTCCGCCGGGCA CTCGCCGAGGAAGGGTTCGAGCACCCCACGCACCGCACCGC CGGCGCCGAGCAGGAGAACCCGCTTGCCGCGCAGCTCGACC CCGGCGTTCGCCGTCAGGTCCCGCAGCAGGCCGGCGCCGTC GGTGTTGTCGCCGCGCAGGCGACCGTCGGCGAGGCGGATCA GGGTGTTCACCGCCCCGGCCCGGGTGGCCCGCTCGCTCAACT CGTCCACCAGACGATAGGCCTCTTCCTTGAACGGCACGGTGA CATTGGCGCCCTTGCCCTGCTCGAAGAAGCGCCGGGCGAAC CCGGGGAAATCGTCCAGCGGCGCCAGTTGCGCGTCATAGAC CAGCGCCTCGCCGGTCTGCTCGGCGAACAGGCGGTGGATCA GCGGCGACTTGCTGTGGCCGATGGGGTTGCCGAATACGCAA TAGCGGTCCATGGGTCGTTCCTTTGCCGGAGTGGGGACGGG ACGAGCGGACTCGTCCCCTGCGGGCGGGTCAGGGCTGGCCG GCGAGCCAATCGCGGTCGGCGAGGAAATACTCGGTCAGGC GCGCTCCCCNCCCNCGGNN Allele: 5 >guaA-IISR853 NGTAGTGAGNAAACCAAAGAACTGGCCNNCCTGCTGGTGN TGGGTGACTTCCGGGGGAATTCCAGCGGTCGTGGGCGCGGG ATTTCTGGCCTTNNAACGTGTGATGAGCCACGGCGACAAGG TCACCGAGATGCCGGCCGGCTTCCACATCCTGGCCAGCACCC CGAGCTGCCCGATCGCCGCCATGGCCGACGATGCCCGCGCCT ACTACGGCGTGCAATTCCACCCGGAAGTCACCCACACCAAG CAGGGCCTGCGCATTCTCTCGCGCTTCGTCCTCGACATCTGCG GTTGCGCCGCGCTGTGGACCCCCTCGAACATCGTCGACGACG CCATCGCCACCGTGCGCGCCCAGGTCGGTTCCTCCAAGGTCC TGCTAGGCCTCTCCGGCGGCGTGGACTCCTCGGTGGTCGCCG CGCTGCTGCACAAGGCCATCGGCGACCAACTGACCTGCGTG TTCGTCGACAACGGCCTGCTGCGCCTGCACGAAGGCGACCA GGTGATGGCCATGTTCGCCGAGAACATGGGCGTGAAGGTG ATCCGCGCCAACGCCGAGGACAAGTTCCTCGGCCGCCTGGC CGGCGTCGCCGACCCGGAAGAGAAGCGCAAGATCATCGGC CGCACCTTAATCGAAGTTTTCGACGAAGAAGCCACCAAGCT GCAGGACGTGAAGTTCCTCGCCCAGGGCACCATCTACCCCG ACGTGATCGAGTCAGCCGGCGCCAAGACCGGCAAGGCCCA CGTGATCAAGTCGCACCACAACGTCGGCGGCCTGCCGGAGG ACATGCAGTTCGAACTGGTCGAGCCGCTGCGCGAACTGTTCA AGGACGAAGTGCGCAAGATCGGCCTGGAGCTGGGCCTGCC CTACGACATGGTCTACCGCCACCCGTTCCCCGGCCCGGGCCT GGGCGTGCGCATCCTCGGCGAGGTGAAGAAGGAGTACGCC GACCTGCTGCGCCAGGCCGACCACATCTTCATCGAGGAACT GCGCGCCTTCGACTGGTACACAGACAGCCCGGGGCGTTCAG TACCAATGCCAAGNTCTAGCTACGCCNTGCAATTCCGCNNCG TAGTCNCTCCTACACCNGCNNGNNTGCCCANTCCTTGNNNCT Allele: 83 >mutL-IISRT853 AAGTCATGGTCAGGCGGCGCAACCNGGTTATCGAGNCAAG CCGCCTCGCCACGGAAGCGGGGGCTCATCACCCGCTCCTCGT ANCATCGTCCGCCGGTGAGGTGGTCGAGCGTCCCGCCTCGGT GGCCAAGGAACTCTGGAAAACAGCCTTGACGCCGGTTCCCG GCGCATTGATGTGGAGGTCGAGCAGGGCGGCATCAAGTTGC TGCGAGTGCGCGACGACGGTCGCGGCATCCCCGCCGACGAC CTGCCGCTGGCCCTGGCTCGCCACGCCACCAGCAAGATCCGC GAGCTGGAAGACCTGGAGCGGGTGATGAGCCTCGGCTTCCG TGGCGAGGCGCTGGCCTCGATCAGCTCGGTAGCGCGCCTGA CCATGACCTCGCGTACCGCCGACGCCGGCGAAGCCTGGCAG GTGGAAACCGAGGGCCGCGACATGCAGCCGCGGGTACAGC CGGCGGCGCATCCGGTGGGGACCAGCGACGAGGTTCGCGA CCTGTTCTTCAACACCCCGGCGCGGCGCAAGTTCCTGCGTGCC GAGAAGACCGAGTTCGACCATCTGCAGGAGGTCATCAAGC GCCTGGCGCTGGCCCGCTTCGACGTGGCTTTCCACCTGCGCCA CAACGGCAAGACCATCTTCGCCCTGCACGAGGCGCGAGAC GAGCTGGCCCGCGCGCGCCGGGTCGGCGCGGTGTGCGGCC AGGCATTCCTCGAGCAGGCGCTGCCGATCGAGGTCGAGCGC AACGGTCTGCACCTGTGGGGCTGGGTCGGCTTGCCGACCTTC TCCCGCAGCCAGCCGGACCTGCAGTACTTCTATGTGAACGGG CGCATGGTGCGCGACAAGCTGGTCGCCCACGCGGTGCGCCA GGCTTATCGCGACGTGCTGTACAACGGCCGGCATCCGACCTT CGTGCTGTTCTTCGAAGTCGATCCGGCGGTGGTGGACGTCAA CGTGCACCCGACCAAGCACGAAGTTCGCTTCCGTGACAGCC GGATGGTCCATGACTTCCTCTATGGGAACCCTGA Allele: 2 >nuoD-IISR853 TNNAGCAGCGGTCGTAGGCGTCGCCGTTGTGGGCCAGCGGT ACCTCGAACTCGAAGTTCTCGTAGCCGGAGTAGGGGCGGGC CTTGCGCAGGTCGAAGTCGCAACCGGTGGCGCGCAGGCCG GCGCCGGTGGTGCCCCACTCGAGGGCTTCCTTGGTGTTGTACT GGGCGACGCCGATGGTCCGGCCGCGCAGGATGCTGTTCTTC AGGGCCGCGGTCTCGTACTCGTCGAGGCGCTTGGGCATCCA GTCGAGGAACTCGCGGACCAGCTTGTCCCAGCCGCGCGGCA GGTCGTGGGCGACGCCGCCGATGCGGTACCAGGCCGGGTG CAGGCGGAAGCCGGTGATGGCCTCGACCACCTTGTAGGCGC GCTGGCGGTCGGGGAAGGTGAAGAACACCGGGGTCATGGC GCCGACGTCCTGGATATAGGTGCCCAGGTACAGCAGGTGGT TCAGGATACGGAAGAACTCCGCCATCATGATCCGGATCACG TCGACCCGCTGGGGCACCTTGATCCCGGCGAGCTTCTCCACC GAGAGTACGTAGGGCAGGTTGTTCATCACCCCGCCGAGGTA GTCGATGCGGTCGGTGTAGGGGATGAAACTGTGCCAGGACT GGCGCTCGGCCATCTTCTCGGCGCCGCGGTGGTGGTAGCCGA TCTCCGGGACGCAGTCGATGATCTCCTCGCCGTCCAGTTGCA GGATGATGCGGAACGCGCCGTGGGCGGACGGGTGGTTCGG GCCGAGGTTGAGGAACATGTAGTCCTCGTTCTCGCCGTGGCG CTTCATGCCCCAGTCTTCCGGCTTGAAGCGCAGGGCTTCCTGC TCCAGGTCCTGCTTGGCGGCGGACAGGGAGTAGGGATCGA ACTCGGTGGCGCGCGCCGGGTAGTCCTTGCGCAGCGGATGG CCCTGCCAGGTCGGCGGCATCAGCATGCGGGTCAGGTGCGG GTGGCCGGTGAAGGTGATGCCGTACATGTCCCACACTTCGCG CTCGTACAGTGGCGTGNCNNNNGGG Allele: 4 >ppsA-IISR853 CTATCGGGGCANTAGNNNNTTGGGCNGTTTTTNNNNGNCNN GTTGNTCTNCGCTNNAGGTAGTGACGTCGATCGCGCCGATCG CGCCCGCTTCGCCTGAGCGACGCCGAGGTCACCGAGCTGGC CAAGCAGGCCATGATCATCGAGAAGCACTATGGCCGCCCG ATGGACATCGAATGGGCCAAGGACGGTGACGACGGCAAG CTGTACATCGTCCAGGCACGCCCGGAAACCGTGAAGAGCCG CGCCAGCGCCACGGTCATGGAGCGCTACCTGCTGAAAGAG AAGGGGACCGTCCTGGTGGAAGGGCGTGCCATCGGCCAGC GCATCGGTGCCGGTCCGGTCAAAGTGATCAACGACGTGTCG GAAATGGACAAGGTCCAACCGGGTGACGTCCTGGTCTCCGA CATGACCGACCCGGACTGGGAGCCAGTGATGAAGCGCGCC AGCGCCATCGTCACCAACCGCGGCGGGCGCACCTGCCACGC GGCGATCATCGCTCGCGAACTGGGCATCCCGGCGGTGGTCG GTTGCGGCAACGCCACCCAGATCCTGCAGGATGGCCAGGG GGTGACCGTTTCCTGTGCCGAAGGCGATACCGGCTTCATCTTC GAAGGCGAACTCGGTTTCGATGTGCGCAAGAACTCGGTCGA CGCCATGCCCGACCTTCCGTTCAAGATCATGATGAACGTCGG CAATCCCGATCGCGCTTTCGATTTCGCCCAGTTGCCGAACGA AGGCGTGGGCCTGGCCCGCCTCGAATTCATCATCAACCGCA AGATCGGCGTGCATCCCAAGGCGTTGCTGAACTTCGCCGGCC TGCCGGCGGACATCAAGGAAAGCGTGGAGAAGCGCATCGC CGGCTATCCCGATCCGGTCGGCTTCTACGTCGAGAAGCTGGT GGAGGGCATCAGCACCCTGGCCGCGGCGTTCTGGCCGAAG AAGGTCATCGTGCGCCTGTCCGACTTCAAGTCCAATGAGTAC GCCAACCTGATCGGCGCAGCTCTACACNNGNNGCCCNNACC NGCCCCNCTACTNCACNCAA Allele: 13 >trpE-IISR853 CTCACTTGTCGATATGTCCATGGCGGGATTTCGCGCGCGGAA GAGTGCCCGCTGGAAGATCGCCCGCAGCGGCGTCCACCGCG TTGAGCCCCCCGCGCAATTGCCCGGTGGACGGTCGGGCCCG ATGTGCACGGCGTTGGGAGGTAACCTTCCATCANCCATTTTTT TCGTGTGACCTTTCACCGCGCCGATATCGGACACCCGCCCCA CGTTCGCGGGGGCCCCCAAGGGCGTGAGCGGCGTTTCGTGC CAGCTTCACCCGCGAGGACTATGAAAACGCGGTAGGAAGG ATCAAGGACTACATCCTGGCCGGCGACTGCATGCAGGTGGT GCCGTCGCAGCGCATGTCCATCGAATTCAAGGCGGCGCCCA TCGACCTGTACCGCGCGCTGCGCTGTTTCAATCCGACGCCCTA CATGTACTTCTTCAACTTCGGCGACTTCCATGTCGTGGGCAGC TCGCCGGAGGTGCTGGTACGGGTCGAGGATGGCCTGGTGAC GGTGCGCCCGATCGCCGGTACCCGTCCGCGCGGGATCAACG AAGAGGCCGACCTGGCACTGGAGCAGGATCTGCTGTCGGA CGCCAAGGAGATCGCCGAGCACCTGATGCTGATCGACCTGG GGCGCAACGACGTGGGGCGGGTGTCCGATATCGGCGCGGT GAAGGTCACCGAAAAAATGGTGATCGAACGTTACTCCAAC GTCATGCACATCGTGTCCAACGTCACCGGGCAATTGCGCGA GGGGCTCAGCGCGATGGACGCGCTGCGGGCGATTCTGCCGG CGGGCACTCTATCCGGCGCGCCGAAGATCCGCGCCATGGAG ATCATCGACGAGCTGGAGCCGGTCAAGCGTGGAGTCTACGG CGGCGCGGTCGGCTACCTGGCATGGAACGGCAACATGGAC ACCGCCATTGCCATCCGCACCGCGGTGATCAAGAACGGTGA ACTCCACGTGCAGGCCGGCGGCGGTATCGTTGCCGACTCGGT GCCCGCGCTGGAGTGGGAAGAAACCATCACACCCCCCGGG ACCAAATCGGCACGATTCCGCCTCGCTGCAGTGAGTTAACCG TTTGGATGACGCGTTCGGAAGGCATGGCGGTTTCATGTGCNT TCAGCNGGTNCNNCGNNNCTAAACCCGCTGGACGGNNNNN TCATNTATTCGGGGCGAANTNGGCGCNAAGAGGGCNGANA AATGCCGCNGCTTGCCNTGNNGCTCANNTGNACGAATTNNN ACAAATTGANN Allele: 7 P. aeruginosa IISR853

26 >acsA-GEB9 NTTGTNCAAAAGAATTGCTGCCCCTTGATGGTCGTGCTGCAT GCCGACCACCGCCGCCTCGGCGACCTTCGGGTGGGCGACCA TCGCGCTTTCCACCTCGGCGGTGCCCATGCGGTGGCCGGAGA CGTTGAGCACGTCGTCGACCCGCCCGGTGATCCAGTAGTAGC CGTCCTCGTCGCGGCGCGCGCCGTCGCCGGTGAAGTACATGC CCTTGAAGGTCTTGAAGTAGGTGTCGACGAAGCGGTCATGG TCGCCGAACAGGGTCCGCGCCTGGCCCGGCCAGGAGTCGA GGATCACCAGGTTGCCCTCGGCGGCGCCCTCGATCAGGTTGC CGAGATTGTCCACCAGTGCCGGTACCACGCCGAAGAACGGC TTGGCCGCGGAGCCCGGCTTCATCGCGTGGGCGCCCGGCAG CGGGGTCATCAGGCAGGCGCCGGTCTCGGTCTGCCACCAGG TGTCGACGATCGGGCAGCGCGACTGGCCGACGGTCTCGTAG TACCACTGCCAGGCTTCCGGGTTGATCGGCTCGCCCACCGAA CCGAGCAGACGCAGGCTGGAACCGTCGGCACCGGCCACCG CCGCCTTGCCTTCGGCCATCATCGCGCGGATCGCGGTCGGCG CGGTGTAGAGGATGTTGACCTTGTGCTTGTCGATGATTTTCGC CACGCGGGTCACGTCGGGGTAGTTCGGCACGCCCTCGAACA GAATGGTGGTGGCGCCGTTGGCCAGCGGGCCATAGACGAT GTAGGTGTGGCCGGTGACCCAGCCGATGTCGGCGGTGCACC AGTAGACTTCGCCCGGACGGTAGTCGAAGACCCGCTCGTGG GTCAGCGAGGTAANANCCNGAGATCGA Allele: 22 >aroE-GEB9 AGCCGGGCAGAGAGGAAGGCGCCTGACCGAGTATTTCCTC GCCGACCGCGATTGACTCGCCGGCCAGCCCTGACCAGCCCG CAGGGGACGAGTCCGCTCGTCCCGTCCCACTCCGGCAAAGG AACGACCCATGGACCGCTATTGCGTATTCGGCAACCCCATCG GCCACAGCAAGTCGCCGCTGATCCACCGCCTGTTCGCCGAGC AGACCGGCGAGGCGCTGGTCTATGACGCGCAACTGGCGCC GCTGGACGATTTCCCCGGGTTCGCCCGGCGCTTCTTCGAGCA GGGCAAGGGCGCCAATGTCACCGTGCCGTTCAAGGAAGAG GCCTATCGTCTGGTGGACGAGTTGAGCGAGCGGGCCACCCG GGCCGGGGCGGTGAACACCCTGATCCGCCTCGCCGACGGTC GCCTGCGCGGCGACAACACCGACGGCGCCGGCCTGCTGCGG GACCTGACGGCGAACGCCGGGGTCGAGCTGCGCGGCAAGC GGGTTCTCCTGCTCGGCGCCGGCGGTGCGGTGCGTGGGGTGC TCGAACCCTTCCTCGGCGAGTGCCCGGCGGAGTTGCTGATCG CCAACCGCACGGCGCGGAAGGCCGTGGACCTGGCCGAGCG GTTCGCCGACCTCGGCGCGGTGCACGGCTGCGGTTTCGCCGA GGTCGAAGGGCCTTTCGACCTGATCGTCAACGGCACCTCGGC CAGTCTTGCCGGCGACGTGCCGCCGCTGGCGCAGAGCGTGA TCGAGCCCGGCCGTACCGTCTGCTACGACATGATGTATGCCA AGGAACCGACTGCCTTCAACCGCTGGGCCGCCGAACGCGGT GCGGCGCGTACCCTGGATGGCCTGGGCATGCTGGTGGAGCA GGCCGCCGAGGCATTCTTCCTCTGGCGCGGCGTGCGTCCTGC CTCGGCGCCAGTGTTGGAGACGCTGCGCCGACAGTTGGCAA CTGTCTGAGTTGTCAGGCGGCATTTGAGACGTANGTNNCAAT TTGGNTTCCATCTG Allele: 5 >guaA-GEB9 GNGAGCGCGAGAGAATNGCGCNNNCCTTCCTTGGTNGGGN TNNATCTCGGGGGGGGAATTGCNNGCCGTCGTAGGCGCGG GATCTGTCGGTCTCTTAAGCGGTGTGATGAGCCACGGCGACA AGGTCACCGAGATGCCGGCCGCGCTTCCACAGTCCGTGGCC AGCAGCCCCGAGCTGCCCGATCGCCGCCATGGCCGACGATG CCCGCGCCTACTACGGCGTGCAATTCCACCCGGAAGTCACCC ACACCAAGCAGGGCCTGCGCATTCTCTCGCGCTTCGTCCTCG ACATCTGCGGTTGCGCCGCGCTGTGGACCCCCTCGAACATCG TCGACGACGCCATCGCCACCGTGCGCGCCCAGGTCGGTTCCT CCAAGGTCCTGCTAGGCCTCTCCGGCGGCGTGGACTCCTCGG TGGTCGCCGCGCTGCTGCACAAGGCCATCGGCGACCAACTG ACCTGCGTGTTCGTCGACAACGGCCTGCTGCGCCTGCACGAA GGCGACCAGGTGATGGCCATGTTCGCCGAGAACATGGGCGT GAAGGTGATCCGCGCCAACGCCGAGGACAAGTTCCTCGGCC GCCTGGCCGGCGTCGCCGACCCGGAAGAGAAGCGCAAGAT CATCGGCCGCACCTTCATCGAAGTTTTCGACGAAGAAGCCAC CAAGCTGCAGGACGTGAAGTTCCTCGCCCAGGGCACCATCT ACCCCGACGTGATCGAGTCAGCCGGCGCCAAGACCGGCAA GGCCCACGTGATCAAGTCGCACCACAACGTCGGCGGCCTGC CGGAGGACATGCAGTTCGAACTGGTCGAGCCGCTGCGCGA ACTGTTCAAGGACGAAGTGCGCAAGATCGGCCTGGAGCTG GGCCTGCCCTACGACATGGTCTACCGCCACCCGTTCCCCGGCC CGGGCCTGGGCGTGCGCATCCTCGGCGAGGTGAAGAAGGA GTACGCCGACCTGCTGCGCCAGGCCGACCACATCTTCATCGA GGAACTGCGCGCCTTCGACTGGTACCACAAGACACCCGGGG CGTATCAGCTCCNCGATCACAACTTGTNCGGCTGGCAATTCA CGCCGGAATTTCCTCATCAACTCGGGGAAGANCCNNNCCTG GTCCN Allele: 83 >mutL-GEB9 TCAGGTGNTCCCGTAGAGGGAAGGTCATGGACCATCCGGCT GTCACGGAAGCGAACTTCGTGCCTGGTCGGGTGCACGTTGA CGTCCACCACCGCCGGATCGACTTCGAAGAACAGCACGAA GGTCGGATGCCGGCCGTTGTACAGCACGTCGCGATAAGCCT GGCGCACCGCGTGGGCGACCAGCTTGTCGCGCACCATGCGC CCGTTCACATAGAAGTACTGCAGGTCCGGCTGGCTGCGGGA GAAGGTCGGCAAGCCGACCCAGCCCCACAGGTGCAGACCG TTGCGCTCGACCTCGATCGGCAGCGCCTGCTCGAGGAATGCC TGGCCGCACACCGCGCCGACCCGGCGCGCGCGGGCCAGCTC GTCTCGCGCCTCGTGCAGGGCGAAGATGGTCTTGCCGTTGTG GCGCAGGTGGAAAGCCACGTCGAAGCGGGCCAGCGCCAG GCGCTTGATGACCTCCTGCAGATGGTCGAACTCGGTCTTCTCG GCACGCAGGAACTTGCGCCGCGCCGGGGTGTTGAAGAACA GGTCGCGAACCTCGACGCTGGTCCCCACCGGATGCGCCGCC GGCTGTACCCGCGGCTGCATGTCGCGGCCCTCGGTTTCCACCT GCCAGGCTTCGCCGGCGTCGGCGGTACGCGAGGTCATGGTC AGGCGCGCTACCGAGCTGATCGAGGCCAGCGCCTCGCCACG GAAGCCGAGGCTCATCACCCGCTCCAGGTCTTCCAGCTCGCG GATCTTGCTGGTGGCGTGGCGAGCCAGGGCCAGCGGCAGGT CGTCGGCGGGGATGCCGCGACCGTCGTCGCGCACTCGCAGC AACTTGATGCCGCCCTGCTCGACCTCCACATCAATGCGCCGG GAACCGGCGTCAAGGCTGTTTTTCCAGGAGTTCCTTGGCCAC CGAGGCGGGACGCTCGACCACCTCACCGGCGGGGACATCA TGAGATTGGAGCGGGTGATGANCCTTGGCTTCCNGGGAGA GGCCGCTCGCCTCCGATCATCTNTTTGTNCGTCTGACCATGAC CTCTCGCN Allele: 2 >nuoD-GEB9 TCTGACATGCAGCGGTCGTAGGCGTCGCCGTGTGGGCCAGC GGTACCTCGAACTCGAAGTTCTCGTAGCCGGAGTAGGGGCG GGCCTTGCGCAGGTCGAAGTCGCAACCGGTGGCGCGCAGG CCGGCGCCGGTGGTGCCCCACTCGAGGGCTTCCTTGGTGTTGT ACTGGGCGACGCCGATGGTCCGGCCGCGCAGGATGCTGTTC TTCAGGGCCGCGGTCTCGTACTCGTCGAGGCGCTTGGGCATC CAGTCGAGGAACTCGCGGACCAGCTTGTCCCAGCCGCGCGG CAGGTCGTGGGCGACGCCGCCGATGCGGTACCAGGCCGGG TGCAGGCGGAAGCCGGTGATGGCCTCGACCACCTTGTAGGC GCGCTGGCGGTCGGTGAAGGTGAAGAACACCGGGGTCATG GCGCCGACGTCCTGGATATAGGTGCCCAGGTACAGCAGGTG GTTCAGGATACGGAAGAACTCCGCCATCATGATCCGGATCA CGTCGACCCGCTGGGGCACCTTGATCCCGGCGAGCTTCTCCA CCGAGAGTACGTAGGGCAGGTTGTTCATCACCCCGCCGAGG TAGTCGATGCGGTCGGTGTAGGGGATGAAACTGTGCCAGG ACTGGCGCTCGGCCATCTTCTCGGCGCCGCGGTGGTGGTAGC CGATCTCCGGGACGCAGTCGATGATCTCCTCGCCGTCCAGTT GCAGGATGATGCGGAACGCGCCGTGGGCGGACGGGTGGTT CGGGCCGAGGTTGAGGAACATGTAGTCCTCGTTCTCGCCGTG GCGCTTCATGCCCCAGTCTTCCGGCTTGAAGCGCAGGGCTTCC TGCTCCAGGTCCTGCTTGGCGGCGGACAGGGAGTAGGGATC GAACTCGGTGGCGCGCGCCGGGTAGTCCTTGCGCAGCGGAT GGCCCTGCCAGGTCGGCGGCATCAGCATGCGGGTCAGGTGC GGGTGGCCGGTGAAGGTGATGCCGTACATGTCCCACACTTC GNNCTCGTACCAGTCGCGTNGGNCAGNN Allele: 4 >ppsA-GEB9 GGACAGGCGCACGATGACCTTCTTCGGCCAGAACGCCGCGG CCAGGGTGCTGATGCCCTCCACCAGCTTCTCGACGTAGAAGC CGACCGGATCGGGATAGCCGGCGATGCGCTTCTCCACGCTTT CCTTGATGTCCGCCGGCAGGCCGGCGAAGTTCAGCAACGCC TTGGGATGCACGCCGATCATGCGGTTGATGATGAATTCGAG GCGGGCCAGGCCCACGCCTTCGTTCGGCAACTGGGCGAAAT CGAAAGCGCGATCGGGATTGCCGACGTTCATCATGATCTTGA ACGGAAGGTCGGGCATGGCGTCGACCGAGTTCTTGCGCACA TCGAAACCGAGTTCGCCTTCGAAGATGAAGCCGGTATCGCCT TCGGCACAGGAAACGGTCACCCCCTGGCCATCCTGCAGGAT CTGGGTGGCGTTGCCGCAACCGACCACCGCCGGGATGCCCA GTTCGCGAGCGATGATCGCCGCGTGGCAGGTGCGCCCGCCG CGGTTGGTGACGATGGCGCTGGCGCGCTTCATCACTGGCTCC CAGTCCGGGTCGGTCATGTCGGAGACCAGGACGTCACCCGG TTGGACCTTGTCCATTTCCGACACGTCGTTGATCACTTTGACCG GACCGGCACCGATGCGCTGGCCGATGGCACGCCCTTCCACC AGGACGGTCCCCTTCTCTTTCAGCAGGTAGCGCTCCATGACC GTGGCGCTGGCGCGGCTCTTCACGGTTTCCGGGCGTGCCTGG ACGATGTACAGCTTGCCGTCGTCACCGTCCTTGGCCCATTCGA TGTCCATCGGGCGGCCATAGTGCTTCTCGATGATCATGGCCTG CTTGGC CAG Allele: 13 >trpE-GEB9 ANNNTGATCGATTAANTTCCNNGNGGGATGTTCGGCGCGCA GGAAAGAGTGCCCGCCTGCAGAATTCGCCCGCAGACGCNTC CACGCGATTGAGCCCCACGCGCAATGACCCGGTGACCGTGG GCCCGATGTGCACGACGTTGGAGTAACGTTCGATCACCCATT TTTTCGGTGACCTTCACCGCGCCGAAATNGGACACCCCGCCC CACGTCGTCTGCGGCCCCCAGTCGTGAGCCGGCGTTTCGTGC CAGCTTCACCCGCGAGGACTATGAAAACGCGGTAGGAAGG ATCAAGGACTACATCCTGGCCGGCGACTGCATGCAGGTGGT GCCGTCGCAGCGCATGTCCATCGAATTCAAGGCGGCGCCCA TCGACCTGTACCGCGCGCTGCGCTGTTTCAATCCGACGCCCTA CATGTACTTCTTCAACTTCGGCGACTTCCATGTCGTGGGCAGC TCGCCGGAGGTGCTGGTACGGGTCGAGGATGGCCTGGTGAC GGTGCGCCCGATCGCCGGTACCCGTCCGCGCGGGATCAACG AAGAGGCCGACCTGGCACTGGAGCAGGATCTGCTGTCGGA CGCCAAGGAGATCGCCGAGCACCTGATGCTGATCGACCTGG GGCGCAACGACGTGGGGCGGGTGTCCGATATCGGCGCGGT GAAGGTCACCGAAAAAATGGTGATCGAACGTTACTCCAAC GTCATGCACATCGTGTCCAACGTCACCGGGCAATTGCGCGA GGGGCTCAGCGCGATGGACGCGCTGCGGGCGATTCTGCCGG CGGGCACTCTATCCGGCGCGCCGAAGATCCGCGCCATGGAG ATCATCGACGAGCTGGAGCCGGTCAAGCGTGGAGTCTACGG CGGCGCGGTCGGCTACCTGGCATGGAACGGCAACATGGAC ACCGCCATTGCCATCCGCACCGCGGTGATCAAGAACGGTGA ACTCCACGTGCAGGCCGGCGGCGGTATCGTTGCCGACTCGGT GCCCGCGCTGGAGTGGGAAGAAACCATCACAGCCCGCCGG GACCCGAGTCGCACGATACCGCCCCCCGGCCTGCAGTGGAA GTTCACCTTTTTGATCACCGCGATGCGGAAGCAATTGGCNNN TTCCACGTTTGNCTTTCANGNCAGTAGGCCACAGCGCCCCCTT AGAACCAGCTNGACCGCTCCNNCTTNATATAATNTCTGGGN GANATTTNCGCCGCTGANGAGTGCTCTGAAGAATCCTCATN NGACATCCGC Allele: 7 P. aeruginosa GEB9

27 Allelic profile of P. aeruginosa based on sequence comparison of seven house keeping genes Strain AcsAroGuaMutNuoPpsTrp 1IISR IISR IISR IISR BP GEB PAO

28 Population snapshot of relationship among the global P. aeruginosa-burst diagram Created by eBurst programme which is based on a novel eBurst algorithm IISR6 & others BP35 & others

29 BP35 Dutch Chinese Strain and IISR51, IISR13 & IISR6 Population snapshot of relationship among the global P. aeruginosa-burst diagram Created by eBurst programme which is based on a novel profuse algorithm

30 1. MLST analysis revealed that the isolates can be grouped into two i.IISR6, IISR51 and IISR13 belong to one Sequence Type ii.BP35, IISR853 and GEB9 belong to another Sequence Type iii. PAO1 formed singleton in the population

31 2. Comparison of the allelic profile with global collection (932 isolates) revealed that the i.IISR6, IIASR51 and IISR13 clustered with a Chinese strain (ST760) has origin in human sputum ( submitted by Yun-Song Yu Zhejiang University, PR-China, )? ii. BP35, IISR853 and GEB9 are SLV of a Dutch strain (ST 575) with unknown history (Submitted by R Van MansfieldUniversity Medical Center Utrecht, Netherlands, )?

32 THANK YOU


Download ppt "Multilocus Sequence Typing of bacteria: a genotypic tool for strain selection Aundy Kumar, *Jos M. Raaijmakers, Santhosh J Eapen Indian Institute of Spices."

Similar presentations


Ads by Google