1. The role of parallel genetic changes in domestication: Fruit size in the plant family Solanaceae Matt Robinson

2. Outline Background Proposed Research  Amplicons  CAPs  dCAPs

3. Outline Background Proposed Research  Amplicons  CAPs  dCAPs

4. Background In tomato studies 28 QTLs have been identified as responsible for fruit weight variance. Similar studies have been done in eggplant and pepper. In these studies there has been several tomato QTLs which have homologs in the other species.

5. From: Ben Chaim et al. 2001, Donganlar et al. 2002

6. Background In tomato studies 28 QTLs have been identified as responsible for fruit weight variance. Similar studies have been done in eggplant and pepper. In these studies there has been several tomato QTLs which have homologs in the other species. The major of these being Fw 2.2.

7. QTL Quantitative Trait Loci (QTL) is a region of any genome that is responsible for variation in the quantitative trait of interest. You can use QTL as a powerful mapping tool when comparing the evolution of a trait between and within members of a species

9. Mapping Population Use a F2 population. Cross a small fruited wild type with a large fruited domesticated type. Cross the resulting F1 generation to obtain the F2 generation. The resulting F2 generation will be used to genotype all the markers. The fruit weight of each individual will be measured.

10. Large Fruited Small Fruited

11. Mapping Population Use a F2 population. Cross a small fruited wild type with a large fruited domesticated type. Cross the resulting F1 generation to obtain the F2 generation. The resulting F2 generation will be used to genotype all the markers. The fruit weight of each individual will be measured.

12. F2 F1 Parental

13. Outline Background Proposed Research  Amplicons  CAPs  dCAPs

14. Proposed Research Use 12 most common QTL in tomato. Seeing if Fw2.2 plays an important role in Physalis Using F2 population Testing using Amplicons, CAPs, dCAPs

15. Outline Background Proposed Research  Amplicons  CAPs  dCAPs

16. Amplicons Detect size differences between the introns sequences of DNA. Run through thick gel matrix.

18. Outline Background Proposed Research  Amplicons  CAPs  dCAPs

19. CAPs Cleaved Amplified Polymorphic Sequence analysis (CAPs). Changes in the base sequence which causes a loss or a gain of a restriction site. This can be used to see which allele the offspring was given by comparing the banding patterns of either parent with the offspring.

20. From: http://www.ndsu.nodak.edu 4 kb 1 kb 5 kb | = restriction enzyme site

21. Outline Background Proposed Research  Amplicons  CAPs  dCAPs

22. dCAPs Derived Cleaved Amplified Polymorphic Sequence analysis (dCAPs). Induce a restriction site by placing it into a PCR primer. This primer binds to mismatches in the DNA template. Then the PCR product is digested by the restriction enzyme and run through a gel.

23. Bs1I dCAPS assay: La-erGTGGAAGAAGCTCGATGAGGCTTTGGGG phyB-9GTGGAAGAAGCTCGATGAGGCTTTGAGG Bs1I CCNNNNNNNGG The B9dCAP primer GTGGAAGAAGCTCGACCAGGCTTTGGGG Bs1I digestion: La-erGTGGAAGAAGCTCGACCAGGCT / TTGGGG phyB-9GTGGAAGAAGCTCGACCAGGCTTTGAGG From: Neff et al.

24. The Big Picture Able to see the special qualities about the region These linked regions (QTLs) have been seen in other types of domestication

25. The end