Presentation is loading. Please wait.

Presentation is loading. Please wait.

Genetics 101/Clinical Significance Camp Sunshine July 22, 2013 Diamond Blackfan Anemia Foundation Diamond Blackfan Anemia Canada.

Similar presentations


Presentation on theme: "Genetics 101/Clinical Significance Camp Sunshine July 22, 2013 Diamond Blackfan Anemia Foundation Diamond Blackfan Anemia Canada."— Presentation transcript:

1 Genetics 101/Clinical Significance Camp Sunshine July 22, 2013 Diamond Blackfan Anemia Foundation Diamond Blackfan Anemia Canada

2 THE FUNDAMENTALS Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease.

3 HUMAN CHROMOSOMES

4 THE FUNDAMENTALS Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease.

5 GENETICS 101

6 GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! Mendel’s tall pea plants and short pea plants make similar offspring: breed true

7 GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! Tall pea plants crossed to short pea plants make tall offspring

8 GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! Crossing the tall progeny of the original cross gives 3 tall plants to every 1 short plant. Mendel’s conclusions: The tall trait masks the short trait, but the short trait is present in the parents. The tall and short traits segregate independently of each other.

9 THE FUNDAMENTALS Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. (Peas have 7 pairs). Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. (Peas have 10s of thousands of genes too). Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease.

10 GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! Mendel’s tall pea plants and short pea plants breed true because they are homozygous (2 copies) for the tall or short trait. T/T t/t

11 GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! Tall pea plants crossed to short pea plants makes heterozygous offspring. The heterozygous offspring are tall because tall is a dominant trait. T/T T/t t/t T/t

12 GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! Crossing the tall progeny of the original cross gives 3 tall plants to every 1 short plant ON AVERAGE. T/TT/t t/t

13 Plant 1- pollen Plant 2 – egg T T t t T/T T/t t/t MENDEL’S CROSS: THEORY

14 THE FUNDAMENTALS Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease.

15 Plant 1- pollen Plant 2 – egg T T t t T / T T / t t / t MENDEL’S CROSS: REALITY T / t

16 PATTERNS OF INHERITANCE Autosomal Dominant: Homozygous and Heterozygous individuals show the trait. Autosomal Recessive: Only Homozygous individuals show the trait. X-Linked: The trait is only seen in males.

17 Attached ears INHERITANCE OF A HUMAN TRAIT

18 Attached ears 1. Non-attached ears does not breed true in this family INHERITANCE OF A HUMAN TRAIT

19 Attached ears 1. Non-attached ears does not breed true in this family 2. Attached ears does not breed true in this family INHERITANCE OF A HUMAN TRAIT

20 Attached ears INHERITANCE OF A HUMAN TRAIT 1. Non-attached ears does not breed true in this family 2. Attached ears does not breed true in this family 3. Attached ears can be inherited from one parent

21 Attached ears 1. Non-attached ears does not breed true in this family 2. Attached ears does not breed true in this family 3. Attached ears can be inherited from one parent 4. A parent with attached ears can have non- attached children INHERITANCE OF A HUMAN TRAIT Is Attached ears inherited as a Dominant or Recessive trait?

22 THE FUNDAMENTALS Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease.

23 Attached ears a/a A/a INHERITANCE OF A HUMAN TRAIT Dominant! a/a

24 Willig T et al. Blood 1999;94: ©1999 by American Society of Hematology DBA IS MORE COMPLICATED: AUTOSOMAL DOMINANT WITH INCOMPLETE PENETRANCE

25 MUTATIONS Mutations are changes in the DNA that are inherited. Deletion: complete loss of a segment of DNA containing multiple gene or part of a gene. Point Mutation: A change in the DNA sequence the amino acid sequence of a protein. Indel: The addition or loss of a base into a sequence that alters the amino acid sequence of a protein. Genes make RNA which is translated into proteins.

26 DIAMOND BLACKFAN ANEMIA MUTATIONS RPS19: Draptchinskaia et al. Nat Genet : RPS24: Gazda et al.. Am J Hum Genet : RPS17: Cmejla et al. Hum Mutation : RPL35a: Farrar et al. Blood, : RPL11/RPL5: Gazda et al. Am J Hum Genet, : RPS10/26: Doherty et al. Am J Hum Genet, :

27 Ribosome 28S rRNA 18S rRNA Small Subunit 40S Large Subunit 60S

28 WHY IS IT IMPORTANT TO IDENIFY THE MUTATIONS IN THE REMAINING DBA PATIENTS? Improve clinical opportunities Stem cell transplant from matched sibling donor WITHOUT the mutation – incomplete penetrance Genotype/phenotype correlations Remission ~15% of patients Steroid responsiveness ~40% of patients

29 Willig T et al. Blood 1999;94: ©1999 by American Society of Hematology THE IMPORTANCE OF GENOTYPING

30 DIAMOND BLACKFAN ANEMIA MUTATIONS RPS19: Draptchinskaia et al. Nat Genet : RPS24: Gazda et al.. Am J Hum Genet : RPS17: Cmejla et al. Hum Mutation : RPL35a: Farrar et al. Blood, : RPL11/RPL5: Gazda et al. Am J Hum Genet, : RPS10/26: Doherty et al. Am J Hum Genet, : Hypothesis: Deletions and copy number variations cause DBA

31 THE FUNDAMENTALS Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease.

32 HUMAN CHROMOSOMES

33

34 SINGLE NUCLEOTIDE POLYMORPHISMS 99.9% of the bases are identical in all people – but that leaves 3 MILLION bases that can be different between any two people ~ 8 million validated human SNPs identified to date –Represent individual point mutations –1 SNP per bp –Human genome may contain as many as 12 million SNPs –Over 200,000 SNPs may be present within genes Provides a means to identify individual parts of a genome

35 DETECTION TECHNOLOGY

36

37 DECIPHERING THE DATA

38 RPS19 DELETIONS

39 High resolution SNP array genotyping n=106 Deletions of known DBA genes ( new genes) Variable, mosaic copy number loss of 3q (2), 13q, 15q (2), 19q Mosaic copy loss of 5q33 (RPS14) (2) DBA COPY NUMBER VARIANT DETECTION ~10% of DBA patients have a deletion of a DBA gene RPS19 RPL5 RPL11 RPS26 RPS24 RPL35a RPS10 RPS17 RPS7 other deletions unknown North American DBA Registry

40 RPS19 RPL5 RPL11 RPS26 RPS24 RPL35a RPS10 RPS17 RPS7 other deletions unknown DIAMOND BLACKFAN ANEMIA MUTATIONS ~30-35% of patients do not have a molecular diagnosis Hypothesis: Mutations in non-ribosomal genes cause DBA

41 SELECTION OF PATIENTS FOR SEQUENCING Resequencing patients without mutations SNP array analysis for Copy Number Variants New patients (screened) negative Family 1 Family 2 Family 3 Family 4 Informed consent for exome capture sequencing North American DBA Registry

42 Minimum requirements: >50 x bp reads 30X coverage; 85% of exome Family 1: 112x10 6 ; 85X; 91.5% Family 2: 109x10 6 ; 79X; 91.2% Family 3: 108x10 6 ; 73X; 90.5% Family 4: 103x10 6 ; 82X; 90.8% WHOLE EXOME SEQUENCING 1 Enrich Sequence Biotinylated probes 29 x 10 6 bp (85% of coding sequence) Select Exome with Streptavidin beads Elute Exome for sequencing NIH Intramural Sequencing Center (NISC)

43 WHOLE EXOME SEQUENCING 2 ref. CATGGTGTCTGTTTGAGGTTGCTA 1 CATGGTGTCTGTTTGAGGTTGCTA 2 CATGGTGTCTGTTTGAGGATGCTA 3 CATGGTGTCTGTTTGAGGTTGCTA 4 CATGGTGTCTGTTTGAGGATGCTA 5 CATGGTGTCTGTTTGAGGATGCTA 6 CATGGTGTCTGTTTGAGGATGCTA 7 CATGGTGTCTGTTTGAGGTTGCTA 8 CATGGTGTCTGTTTGAGGTTGCTA 9 CATGGTGTCTGTTTGAGGATGCTA … n CATGGTGTCTGTTTGAGGTTGCTA MPG: CATGGTGTCTGTTTGAGGTTGCTA A 8-10,000 variants/patient AlignFilter Variants in 1000 Genomes Variants in ClinSeq <100 variants per patient NIH Intramural Sequencing Center (NISC)

44 THE FUNDAMENTALS Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease.

45 WHOLE EXOME SEQUENCING 3 VarSifter Analysis of inheritance CDPred score (severity) Erythroid expression Gene function De novo X-linked Aut. Dom. Aut. Rec. ~5 candidate mutations/family Prioritize Functional Validation Frequency Validation

46 KNOCKDOWN OF RPL15 AND RPL31 INHIBITS RED CELL PRODUCTION IN VITRO ∂ Luc shRNA RPL15 shRNA ∂ RPL31 shRNA ∂ ∂ CD41 CD235 RPL15 RPL31 Relative mRNA Level Luc L15 L31 shRNA

47 FINAL THOUGHTS Thanks to all of you who took the time and made the effort to be here. You are providing the most valuable contributions of all: Hope, Support and a Sense of Community. No DBA patient or family could feel alone in the presence of people like you. Any researcher would feel inspired by all of you.


Download ppt "Genetics 101/Clinical Significance Camp Sunshine July 22, 2013 Diamond Blackfan Anemia Foundation Diamond Blackfan Anemia Canada."

Similar presentations


Ads by Google