Presentation is loading. Please wait.

Presentation is loading. Please wait.

Sinorhizobium ----MT-----ALDIQISV-EAGDWPPEDELQSFCERVLEAAADFLAREENQPLPAQAAE 50 Brucella ----MHNVSDNAIHIDIMI-EAGNWPDEASLESLVSKSVAAAWNNLG------LKSATSE 49.

Similar presentations


Presentation on theme: "Sinorhizobium ----MT-----ALDIQISV-EAGDWPPEDELQSFCERVLEAAADFLAREENQPLPAQAAE 50 Brucella ----MHNVSDNAIHIDIMI-EAGNWPDEASLESLVSKSVAAAWNNLG------LKSATSE 49."— Presentation transcript:

1 Sinorhizobium ----MT-----ALDIQISV-EAGDWPPEDELQSFCERVLEAAADFLAREENQPLPAQAAE 50 Brucella ----MHNVSDNAIHIDIMI-EAGNWPDEASLESLVSKSVAAAWNNLG------LKSATSE 49 E.coli MSQVILDLQLACEDNSGLPEESQFQTWLNAVIPQF QEESE 40 Vibrio MS-IELDLQLAVENEHGLPSEAEFALWLTRTITPF QAQAE 39 Haemophilus MGSVLVDLQIATENIEGLPTEEQIVQWATAAIQPE GNEVE 40 Pseudomonas MGAARAVTMPLELDLQVAS-DAADLPSEAQFRAWCELALRQ RAESE 45 Mycobacterium ---MREHLMSIEVANESG--IDVSEAELVSVARFVIAKMDVN PCAE 41 Staphylococcus MFTIDFSDHTGLVKDAWYKQIEDLLEFAKKEEHIE DDAE * Sinorhizobium LSLVFTDDQSIRAINAEWRGQDKATNVLSFPAFPVTPGR------MPGP-MLGDIVVAHE 103 Brucella LSVVFTDDASIQLLNGEWRGKDKPTNVLSFPAFPVKAGS------QPGP-MLGDIVIARE 102 E.coli VTIRVVDTAESHSLNLTYRGKDKPTNVLSFP-FEVPPG MEMS-LLGDLVICRQ 91 Vibrio VTVRIVDEAESHALNLNYRGKDKPTNVLSFP-FEAPPG MEMD-LLGDLVICRQ 90 Haemophilus MTVRIVDEAESHELNLTYRGKDRPTNVLSFP-FECPDE VELP-LLGDLVICRQ 91 Pseudomonas LTIRLVDEAEGLELNSTYRHKDYATNVLSFP-ADVPEEF------LDIP-LLGDLVICAP 97 Mycobacterium LSMLLLDTAAMADLHMRWMDLPGPTDVMSFPMDELEPGGRPDAPEPGPS-MLGDIVLCPE 100 Staphylococcus LSVTFVDKQEIQEINRTYRDKDKVTDVISFALEEDEPDIDFSG--LDIPRVLGDIIICTD 97 :::. * :: : *:*:**. :***:::. Sinorhizobium TLRREAAELEKPFDAHLTHLLVHGFLHLFGYDHIEDDEAERMEGLETRILARLGLSDPYG 163 Brucella TVEREAKEEGKPIENHLSHLVVHGFLHLLGYDHETDEEAEVMEAREREILHALAIPDPYA 162 E.coli VVEKEAQEQGKPLEAHWAHMVVHGSLHLLGYDHIEDDEAEEMEALETEIMLALGYEDPYI 151 Vibrio VVEREAIEQNKPLQAHWAHMVVHGSLHLLGYDHIEDDEAEEMESLETEIMQEMGFTDPYL 150 Haemophilus VVEREAAEQEKPLMAHWAHMVVHGGLHLLGYDHIEDDEAEEMESLETQIMQGLGFDDPYL 151 Pseudomonas VVAREAREQHKPLQAHWAHLVIHGCLHLLGYDHIDDAEAEEMETLERELLAELGHPDPYA 157 Mycobacterium FAAEQAAAAGHSLGHELALLTIHGVLHLLGYDHAEPDEEKEMFALQDRLLEEWVADQVEA 160 Staphylococcus VAQEQANNYGHSFERELGFLALHGFLHLLGYDHMTEADEKEMFGRQDTILNAYGLTRD :* :.:. : :** ***:**** : : * : :: Sinorhizobium DQPPH Brucella VSDEDINND E.coli AEKE Vibrio AEKE Haemophilus AEK Pseudomonas CDDEEPPSKEK Mycobacterium YQHDRQDEKDRRLLDKSRYFDL 182 Staphylococcus B. A. Figure S1

2 Pink nodules White nodules Green leaves Yellow leaves Height (cm) Number / plant Dry weight (mg) Rm1021 hfq smc01113 Figure S2

3 72h Rm1021 hfq smc h B. A. Figure S3

4 sra03 sra16 sra35 sra45 sra47 sra51 Figure S4

5 Sra16 >S meliloti AGGAATCTCAGAAGACGAAAGTTCTGCTCGTTGCGCGGCCGTGCTCAAGATTGACGACGATCGATATCGCCGCCATTGCGAGCGTTGCGGTGATGATGGCGCCTATTCCAAGAACAA TCATTGTTCACGTCCCGTGGTGCACCGTCATGATGCCGCCCTGTGCCTGAAGATGCTACTCAACGCGTATTTCGCGCCATTACACCTGCATGTTTTGAATCGCAGACGACACAAGAAAC ATGCAGCACTTCAAATGCTCTAGCGACCTCTGCCCGTCCGATGAGAGACGCATGGCGCTGTATGCTTCGATACTGAACGGCAAGTAGATCCGCAATTCTAAACTCTCATCATTGAAAA CCTGTGGCTGCGTTCAAAGAAAACGTTGCATCGATAGTGGACGGCAAAGCTCCGGTTGAATTTTAGCGATTCCGGTTAAGAGGCAGGAGGCATTAACTTTCAAGCAAGGAATTAACC ATAAACATGGTCCAACACGTCGGAATAGGAAGTCTCGACTTCTCCTCAAGGCATGATGCCGCACCGCCGTACCGGTTTCGGTCCGGTATCCACTTTCACTGAAATCACTGTGGGACGG ACGATGGCGGGCGCTTCCGGGCGCGCTGCTCTCATCGGGTGGGCGTGACCGGCCGCCGGCGGCGACCCTTCCCCAGCGGATTTCGAATGCGGGACGCATCAGCAGCCGGGGACCA GC >S medicae TCTCAGAAGACGGATGTTCTGCTCGCTATCCGGCTCTGATCCAGATTGACGACGATCGAGATCGCCGTCATGGCGAGCGTTGCGGTGATGATGGCGCCTATTCCAAGAACAATCATTG TTCGCGTCCCGTGGCGCTTCGTCATGATGCGCCTGTGCCTGAAGATGCTACTCAACGCGTATTTCGCGCCATTCCCTGCATGCTTGATCCCCGACCGATCCAGAAACATGCAGCACCTC AAATGCTGGAGTGACCCCGCGCGTTAGGACGCACGGCGCACTATGCTTCGATACTGGACGCCGGTTAGATCCACAATCCCTGAACAATCATCATTGAAAACCTGTGGCTGCACTCGG CAAAAACGTTGTATCGTCAGCGTCCGATACCGCCACGGTTGAATTTTAGCGATACCGGTTAAGAGCCATGTGCCGTTAACCTTCAGGCAAGGAATTAACCATAAACATGGTCCAACAC GGCGGAATGGGAAGCCTCGGCTTCTCCTCAAGGCATGATGCCGCACCGCCGTACCGGTCTAGGTCCGGTATCCATTTTCACTGAAATCACTGTGGACGAACGATGGCGGGCGCTTCG GAGCGCGCTGTTCTCATCGCTTGCGTGTGACCGGCCGCCGGCTGCGATCCTCTTCCCGGGACGATTTCTATCAGGCGCGCGTCAATAGCCGGGGACCAGC >Rhizobium sp. NGR234 TTCGATACTGGACGACAAGTAGAACCGCAATTCTAAACTCTTGTGATTAAAAACCTGTTGTCTCCGGTAGAGTAAAACAGTGCAAGACAGCGGCGAGTAGCGCGTTGGTTGAATTTTA GCGATTCCGATTACGGGCTGGAAACCGTTAACCTTCAAGCAAGGAATTAACCATAAACATGGTCCAACACGTCGGAATAGGAAGTCTCAGCTTCTCTCAAGGCATGATGCCAAGCCG CCGTACCGGTTCCGGTCCGGTATGCAATCTCACCGAAGTTACTTGCGGGATGGACGATAGAGAACGCTCAGGCGCGCCGATTTCATCGACTGGGCGTGACCGGCC >R leguminosarum bv. trifolii ATTAACCTTCAAGCAAGGAATTAACCATAAACATTGATGTACACGTCGGAATGGGAAGATGCACTCGTTCCCACCAGGCATGACGCCGTCCCGCCGTACCGGGTTGATCCGGTATCCA >R etli CIAT 652 ATTAACCTTCAGGCAAGGAATTAACCATAAACATTGGTTTACACGTCGGAATGGGAAGATGCACTCGTTCCCACCAGGCATGACGCCGTCCCGCCGTACCGGTTGATCCGGTATCCA Sra03 >S meliloti GCGGCCATGGATAGCGCGAGGCAGGGGAAAGGTCCATTGCGCTTTTCCCGCACTACCCTATTAAGTCGAGCGGCAAAGGCATTGCCGGAGCCCTGAAGTTCGGCGCCGAACACTCA CGCAAACGTTACGCATTTGTAATGCGCGATTCGGTCGGCCTATCCTTGAAATGCCACATTTCAATCCACAAATCATGTCGAGCGGCACTCATACAATGCCGTGAGTCTGGTGATTGGCC TGTCCCCCGCCCGCACCAGATGAGGACAAAGGCCTCATCCCCCTCTCCGGGCCTTTGTCCCGCTTTCAAAGAGCCGCCACGGCGCAGCCTCCGCGCCGTGGCGGTTTTTTGTTGCCTTT GCCCGACGGTCGAAAGCGTTTCGCCACGCAGTCTCAAATCCCCGTGAAGTCGGCGCAGTTCGGCTTCATTGCAGGCATTGTAACTTGTCTTCGCGCTCCTTCCCGCGTAGGCATAGGC >S medicae GCGGCCATGGATAGCGCGAGGCAAAGGAAAGGTCCATTGCGCTTTTCCGTTTGCCGCACGACTTAACAGGATGGCGCAGGAGGCTCCGGACACTCACGCAAACGTTACGCATTTGTA ATGCGCGATTCAGTCTGCCAATCCTTGAAATGCCACATTTGGCACCACAAATCATGTCGAGCGGCAGTCATAAAATGCCGTGTGTCTGGTGATTGGCCTGTCCCCCGCCCGCACCAGA TAAGGACAAAGGCCTCATCCCCCTCTCCGGGCCTTTGTCCCGCTTTCAAAAAAACCGTCACGGCGCCGCCTCCGCGCCGTGACGGTTTTTTATTGCCGGTAACAGCGCGCAGGGGCGG CTACCAGCGCGATCTCAAATCCCCGTGAACTCGGCACAGATAGGCTTCATCGCAAGCATTGTAACTTGTCATCGCGCCCCTTCCCGCGTAGGCATA >Rhizobium sp. NGR234 CTCACGGAAACGTTACGCATTTGTAATGTGCGAGTCGGCCGGGCAATCCTTGAAAAGCCACATTTAAATCCTCAAATCAGGGTGAGCGGCACTCAAACGATGCCGTCGTCTGGTGATT GGCCTGTCCCCCGCCCGCACCAGATGTGGACAAAGGCCTCATCCCCCTCTCCGGGCCTTTGTCCCGCTTTCACGAAGCCGCTACGGCGCCGCCTCCGCGCCGTAGCGGTTTTTGTTTGC >R leguminosarum bv. trifolii CTCACCAAACTGTTACCGATTTGTAACGATCGCCCTCCCTTGAAAAACCACATTCTGAGCCACAAATCCATGTCACCGGCGCTTGATCGCGTCGCGGGTCTGATTACCGGCTTGTCCCC CGCCGCGTCAGGCTTGGACAAAGGCCTTATCCCCCTCTCCGGGCCTTTGTCCCCACTTTAAAGTCGCCATGGCCAACCTCCAGGCCATGGCGACTTTT >R_etli_CIAT_652CCTTGAAAAACCACATTCGCAGTTACAAATCCATGTCACCGGCGCTTGATCGTGCCGAGGGTCTGATCACCGGCTTGTCCCCCGCCGCATCAGGCTTGGACAAAG GCCTTATCCCCCTCTCCGGGCCTTTGTCCCCATTTTAAGGTCGCCATGGCCAACCTCCAGGCCATGGCGACTTTT Sra35 >S meliloti TAGAGCGTAAGCCAATAGGAATGGGCAGGTCGATTCATCGGCCTGTTCGGCGGAGCGATCCGCATCGCGTGGGAGGTTTCCGACCTTAAGCCGGGTCGGTTCATCCGCACCACGCA ACCGCAGCCGCCGATCGATCGATCGGCAAATGGCCGGGCAACCGGCTGATGAGCTCCCTTTTCGGCCTCGCCGCAAAGGAGCAGTGAAAGGCAGAGAGAA >S medicae ATGGGCAGGTCGAAACGTCGGCCTGCTCGGCGGAGCGATCCGCATCGCGTGGGAGGTTTCCGGTCTTAGCCGGGTCGGTCTATCCGCACCACGCAACCGCAGCCGCCGATCGATTG ATCGGCAAGTGGCCGGGTTAACCGGCTGATGAGCTCTCTTTTCGGCATTTGCCGCGAAGGAGCAGTGAAAGGCAGAGAGAA >Rhizobium sp. NGR234 AGAGCGAAGCTTACTGAATTGGGCAGGTTGACGTGTCGACCTGTTCCGGCGGAGTGATCCGCATGCGCGTGGGAGGAAGCCGGTCTTAGCCGGGCCGGTATATCCGCACCACGCAA CCGCAGCCGCCGGTCATCGACCGGCAAGGAGCCGGGCAACCGGCTGAACAGTTCCCGCTTCCGGCTTGGCCGGGCGGGGCAAAGAGAGGCAGAGAGAA >R leguminosarum bv. trifolii CGGCCTGTTTCCTGCGGACCTTGTCCGCATCCGCGTGGAAGGTGAGGGGTCTTAGCCGGACCCTAATGATCCGCACCACGCAACCGCAGCCGCCGGAGAGATCCGGCATCACGGGCC GGGCGACCGGC >Rhizobium etli CIAT 652 GGCCTGTTTCCCGCGGACCTTGTCCGCATCCGCGTGGAAGGTGAGGGGTCTTAGCCGGACCCTAATGATCCGCACCACGCAACCGCAGCCGCCGGAGCGATCCGGCATCACGGACC GGGCGACCGG

6 Sra45 >S meliloti GACGGAAATGGCCGACCTGATCAAGGAGCTCGTAAGCGGGGTCGTTGACAGCGCGTTGAAAGAGATCCTCAAGAAAACCAGAGCGACCGGAA CCGCGGCCAAGCGGGCGAAACGGCGAAGCAGGAAAGCCAAGTCAGGCGGCATACTGGCTGACATCGTCGAGGCGGCCTTCCGTAAACCGGC AAAGAAGCAGGTGAGCCGTCGCCGGACCGCGGCTTCCCGGAGCAAACTGCGCCGCCGCTCGGCCTAGATCACGTGTTCTAAGCCTCATCCCG CCCCGAGAGTGGTGCGGAAGCCGAACTTTGAGGGACCATCAATAATTTTGCGATTGGGTGGTGAAAACCACGTCCATGCGTGCTATCTAGACC CTAATCGATATCCGGTCCTTGAAACCGGCGCAGGAAGGAAGACGAG >S medicae AATGGCCAACCTGGTCAAGGAGCTCGTGAGCGGGGTCGTTGACAGCGCACTGAAAGAGATACTCAAGAAAACGAGAACGACCGCGACCAAGC GGACCAGACGGCGAAACAGAAAAACCGCATCCGACGGCGGCATACTGGCGGATATCGTTGAGGTGGCTTTCCGTAAGCCGGCAAAAAAGCAG GTGAGCCGTCGCCGGACCGCGGCCTCCCGGAATAAACTGCGCCGCCGCGCAAAGTCGTAATCGCGTTCAGCTTCCTCATTCCGCTGCTAGAG TGGTGCGGAAGCCGAACTTTGAGGGCCCATCAATAATTTTGTGATTGGGTGGTGAAAACCACGCGCATGCGTGCTATCTAGACCCCGATCGAC ATCCGGTCCTTGAAACCGGTGCAGGAAGGAAGACGAG >Rhizobium sp. NGR234 ATGGCGGATCTGATCAAGGAACTCGTCAGCGGCGTAGTCGACAGCGCGCTGAAGGAAATTCTAAAAAAGGCGGGTGCGAGAACAAGCGCAAC GCGACGCACGAAGCGCCGTACAAGAAAATCGTCGACGGGCGGCGGTATCCTTGCGGACATCATCGAGGCGGCGATCCGCAAGCCGGCAAAG AAACAAGTGAGCCGGCGCCGCACCGCGGCTTCGCGCAGCAAAGTGCGCCGCCGCACCGCCTGAGGTGGTTCGAAAGCCAAATTTTGAGGACC ATCAATATTTAACGAGATTGGTGGTGAAAACCGCGCCCATGCATGCTATTTAAGCTGCAAAGGCGACATCCGGTCCTTGAAGCCGGC- CAGGAAGGAAGAC Sra47 >S meliloti GAGTTGGTCTCCCTCACAGCGCTACGGTCCAATCAGACGCAAAAGTCGCCGTAGCACCTGGTTTTGCTGCCTGTTTCCGGATCGACTGCGATC CGGCGACATGCAGCCGGCGCGGACGGCGTCATGCCGGCCTTCGCCTGCCTCTTCGTTTCCCGTCCACCGCAAGAAGTTCGCCCCTTCCGCAG ACGCGCATATGCACGCGCCGAGCCGCTCCGCATTCGGGAATGCGTCCCGATCGCGGATGAAGAATGCTCCGGAATCAAAGGGCTAGAGCGTC CTTGAACGAGGCGTGCAGCAAACGGCCGCGCCCGGCGCCCGTTAAAGGCTCCAAGCCCGCATGCCTGAATCGCTGCACGGTCCGCCCGTAA GCAGTACCGTGTCGACAGCCGTCAAGGCTGCACCACGCCTTCGTCACAAAGCACGAAGGACTCTCTAGCGCTTTGAGGCTGCATGGCCGGCC CCCGAAAATCGAATATGGATTTTCAGCCCGGTGTTGCAGCCGGCCCGCGAATTGCAATGGCCGTGCCCCCAACCTGATGGCGGTCGCTTTGCG AGAGTTCGAAATTCCCCTGCCAGCCGGTGGTTAGCAGGCGAAAACTTGCCGGTTAGGTGAAGCGAAATTGTGGCAAGGACCGCTTCTCTTGCG CAAATGGCGCAAATTTCTTCGCCGATTCGCTACTGTGACCCAGGAATGGCGCGTTTTTGCCGGTCGCTGGGCGGCTGTTTGACGATTATCCTGC GCCCCGCCGGCCTTGCCAATGGAGGGCTGGCATCGCTGCTTTCAGGG >S medicae AAGTCGCCGTAGCATTGGATTTGCCGCATGGATCCGCTAAGTTCCGATGCCATGCAGCCGGCGTGACCGGCCTGATGCCGGGCCTTGCCTGC GTCTCTTCCCGTCCATCGCAAGAGATCGTCCTTCCATAGACGTGCATTCGCGCACACCGAGCCATTCCGCATTCGGAGATACTCCCGACTGCAG ATGAAATACTCCGGAACCAAAGGGCTAGAATGTCCTTGACCGAGGCGTACAGCGAATAGCGCGCCCGCTCGTTGGAACGCCCTGTCGGACGC CGGTACGGGACAAGCTGATACGCTGCGCGGTCCCGCCCGAAAGCGGCACCGTCCCGGCAACCATCAAGGCTGCACTCCGCCTTCGTCTCAAA ATCCGAAGGACTTTCTAGCGCTTTGAGGCTGCACGCTCCGTAGCCGAAATCGAAATGGATCCTCGGCGCACAGTGATGCAGCCGGCCAATTGC AATGACCGTGCCCCAACCTGATGGCGATCGCTTTGCGAGAGTTGGAATTCCCCTGCCAGCCGGTGGTTAGCGGGCGGAAATCTGCCGGTGAG GTGAAGCGAAATTGTGGCAAGGTCCGCTTCTATTGCACAAAAGCCGCCGTTTCTTCGCTAATTCGCTATTTAGGCCCAAGAAAGGAGCGTTTCT ACCGGTC >Rhizobium sp. NGR234 GCGCGGGCCGGCCTCATGCCGGGTTGCGCCGCTCTGCGTTTCCGTCCATCGCACCGGGTATGCCCCCCGTAGGCGCGCAAATTCCTTGCACG CAAAGAGCCGCCCGCGTTCGGGAGAGCGTCCCGAACGCGCGAATGAAATGCTCCGGAATCAAAGGGCTAGAGCGTCCTTGATCGAGGCGCG CGACAAACCTCAGGCGAACCTGAGAGGCCGAAGCTTTGCATGGCTCCGCCCGAGAGCGGTGCAGCCCTATGGCAACCACGCAAACTACATCA CGCCTTCGCTACGACGTACGAAAGACTCTCTAGCGCTTTGAGGCTGCACATCTCCTATCGCTGGATCCCGATGTCGAGTTCCAGGATTGAAGTT GCAGCCGGCCCGCAAACTGCAATGGCCGTGCCCCAACCTGATGGCGGTCGCTCAGCGAGATATGGAATTCCCCTGCCAGCCGTTGGTCAGCG TCAGGACTTTGCCGGTGAGGTGCAGCGAAATTGTGGCAGAGATCGCGCCTAACGTGCGCGAGGCGCGCATTTCTACGCCGATCCGGCTGGAT CGACCCAAAATTGGCGCG Sra51 >S_meliloti ACAGCGGCTTCTGCTAGCCGTTCCGTGCAATTTCTCCGCGCGCTTGGCGCCCGGGTTAATACTACTAATACTCTCCGAAACCCCTCAATTTTGC TTGGAACGGCGAATTTCGCTTGAGCCGGCAATATATCCTGCAGTTTTTCTGTAGGCATGAAGGCGATGGTCCCTCGGACCAGTGCGCTGCGTG AACGACAAGCGATATCAGGCGCTTGGACCGGGAAACCAGGCTGCACAAAGTTGCGGCATACCCATGAGCGACGGAATTTGGCGCAAATGATCC TGCCGCGCCCCAATCTTTGGTCGAAAAGCTTTGAATTCAACAGCTTGCAATGCTTTTTGAATACGCGAGTCAAAACGACCAACTGACCTCTTTTT GAGCAATGAGAAGACGCAATACCTCGTCAGAAAAGTTTTGCTTGCCAATTCAAAATAAACCCATCACTCTTACTGTGTTCGGGCAATCTGCGAAC ACGGGAAGATCTTGAATAAAAGCGGGCCGGAGACGCAACCCACTCCGGGCGGCCAACGGGGGGAGGCTGTTATTCCTTCCTGCGGCTGGTCG CGATAACCAGGACCCTTTCCTCAATTGTCGAGAACTGCCCCCACGCCCATATCGGGCAAAACTGCAATGCTGCCCGCAACGCGGGTGGAGAGA AAAGGACCTGACGC >S_medicae ACAGCGGCTTGCGCCTGCCGCGCCGTGCAATTTCTCCGCGCCCCGAATAAGGGTTAATACTACTAATACTCTCCAAACCCCTCAATTTTGCTTG GAACAGCGAAAAGCCTTCGGGCGGCAAGATATCCTTTAGTTTTTCTGTAGACATGCGCGCTGTGCTCGCACTCGCCGCCATGCTGCGAGAACC AGCAGCGATATCAGGCGCTTGGAGGGAGAAACCCGGCTGCACAAAGTTGCGGCAAGCCCATGAGCGACGGAATTTGGCGCAAATGGTCCACC CTGCCCCGAGCGTCTACCCAAAAAGCTTTGAATTCAACAGCTTGCGATGCTTTTTGAATAATGGAATCTAATCGCCGAACTGACCTCTTTTTGAG CAATGAAAAGACGCAATACCTCGTCAGAAAAGTTTTGCTTGCCAATTCAAAATAAACCCATCACTCTTACTGTGTTCGGGCAATCTGCGAACACG GGAAGATCTTGAAATAAAAGCGGGCCGGAGACGCAACCCACTCCGGGCGGCCAACGGGGGAGGCTGTTTTTCCTTCCTGCGGCTGGTCGCGA TAACCAGGACCCTTTCCTCAATTGTCGAGAACTGCCCCCACGCCCAAACTGGGCAAAACTGCAATGCTGCCCGCAAATCGGGTGAGTGAAAAG GACCTGACGC >Rhizobium_sp._NGR234 AATTGACCTGTTTTTGAGCAATGAGAAGACTCAATACCTCGCCGGAAAAGTTTTGCTTGCCAATTCAAAATAAACTGATCACTCTTACTCTGTTCG GGCAATTTGCGAACGCGGGAAGATCTTGAAATAAATGCGAGCCGGAGACGCAAACCACTCCGGGCGGAGAATCGTGGGAGGGCCAATTTGCC ATCCTTCTCAAGGTTCGCTGCGATAACAGGACCCTTTCCTCAATTGTCGAGAACTGCCTGCCCCACGCCCTTCCGGGCAAACTGTAATGCCACC CTTCGACCGGGTGGAGAGAAAAGGACCTGACGC

7 >R_leguminosarum_bv._trifolii CGTTAAAAAACTTTTGCTTGCCAAAGTCCTTTAAACGCAGCACTCTCAGCGTGTTCGGGCATTTTGCGAGCATGGGAAGTCCTTAAGTATTTGCG CGCCGGGAACGCTAATATCCCGGTCAGCCGGTTCCGAAAATGGCGGGCGAAAGTCCTGCCTGGAACAGGTCGAGGTAGAGGGGACCTTTTTC TCAAATTTCAAGAATTGCCTGCCAACACCTCCCGCAAGGAGGGCAATGCTATGATGCTGCCCGTGTGGATGGCGGGCAGAGAGAAAAGGACCT GAGGC >R_etli_CIAT_652 CGTTAAAAAACTTTTGCTTGCCAAAATCCCGGAAACGCCGCACTCTCGCCTCGTTCGGGCATTTTGCGAGCATGGGAAGTCCTTAAGTATTTGC GCGCCGGAAACGCTAATATTCCGGTCAGCCGGTTCCAAAAAAGGCAGGCGAAAGTCCTGTCTGGGGCAGGCCGAGGTAGAGGGGACCTTTTT CTCACATTTCAAGAATTGCCTGCCAACACCTCCCGCAAGGAGGCAATGCTATGATGCTGCCCGTGTGGATGGCGGGCAGAGAGAAAAGGACCT GACGC Figure S5


Download ppt "Sinorhizobium ----MT-----ALDIQISV-EAGDWPPEDELQSFCERVLEAAADFLAREENQPLPAQAAE 50 Brucella ----MHNVSDNAIHIDIMI-EAGNWPDEASLESLVSKSVAAAWNNLG------LKSATSE 49."

Similar presentations


Ads by Google