Presentation is loading. Please wait.

Presentation is loading. Please wait.

© life_edu Lecture 32 Part I. DNA-Based Forensics: The Real Story Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us.

Similar presentations


Presentation on theme: "© life_edu Lecture 32 Part I. DNA-Based Forensics: The Real Story Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us."— Presentation transcript:

1

2 © life_edu Lecture 32 Part I. DNA-Based Forensics: The Real Story Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us Forensics

3 Issues in Biotechnology: Biotechnology, Our Society and Our Future OnCampus Live BCH 190, MIC 190, AFS 190, NRS 190, PLS 190 OnLine BCH 190 A Sweeping General Survey on Life and Biotechnology A Public Access College Course The University of Rhode Island Kimberly Nelson Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us

4 © life_edu A Sweeping General Survey on Life and Biotechnology The University of Rhode Island Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us BCH 190 Section II. The Applications of Biotechnology

5 Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us Forensics DNA-based Forensics: The Real Story The National Forensic Debate: Public Safety vs. The Right of Privacy Trace Evidence

6 © life_edu Lecture 32 Part I. DNA-Based Forensics: The Real Story Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us Forensics

7 The Rhode Island State Crime Lab: Forensic Examinations Dennis Hilliard, Director Amy Duhaime Criminalist III Rhode Island State Crime Lab

8 © life_edu Lecture 32 Part I. DNA-Based Forensics: The Real Story Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us Forensics

9 The Rhode Island State Crime Lab: Forensic Examinations Dennis Hilliard, Director Amy Duhaime Criminalist III Rhode Island State Crime Lab

10 Connecticut State Forensic Science Laboratory Michael Adamowicz, Criminalist Carll Ladd, Lead Criminalist Forensic Biology

11 Biotechnology Stocks Project Time to cash in (or out) as the case may be!!! What happened to your $100,000.00!!!!!!! Invested in Biotech. Stocks this Semester? 1. Select and Research five Biotech companies. 2. Print out the current stock quote and annual chart. 3. Invest chosen amounts in each. Calculate shares in each. 4. Monitor Stock. 5. Print out the stock quote and annual chart Weds. 6. Calculate gains and losses. Submit report.

12 To whom much is given, much is required Luke 12:48 Once you know, you cannot unknow Kausch, The Abandon In much wisdom there is grief in much knowledge there is pain Ecclesiastes 1:18 Now that you know, know that you now Kausch, The Abandon

13 Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us Forensics DNA-based Forensics: The Real Story The National Forensic Debate: Public Safety vs. The Right of Privacy Trace Evidence

14 I typically watch TV: (A) 0-2 hrs/day (B) 2-3 hrs/day (C) 3-5 hrs/day (D) 5-10 hrs/day (E) over 10 hrs/day

15 The average American watches TV: (A) 0-2 hrs/day (B) 2-3 hrs/day (C) 3-5 hrs/day (D) 5-10 hrs/day (E) over 10 hrs/day

16 I typically watch TV: 4 hrs X 365 = 1460 hrs/yr 1460 hrs/yr ÷ 16 hrs waking hrs/day = days/yr days/yr over 50 yrs = days or 12.5 yrs

17 Does watching TV influence teenage sexual behavior? Does watching TV influence teenage violent behavior?

18 Children And TV Violence 2012 Hundreds of studies on the effects of TV violence on children and teenagers have found that children may: become “immune” or numb to the horror of violence gradually accept violence as a way to solve problems imitate the violence they observe on television; and identify with certain characters, victims and/or victimizers

19

20 Nearly 2 out of 3 TV programs contain some violence, averaging about 6 violent acts per hour. The average child who watches 2 hours of cartoons a day may see nearly 10,000 violent incidents each year, of which the researchers estimate that at least 500 pose a high risk for learning and imitating aggression and becoming desensitized to violence. Center for Communication and Social Policy, University of California, Santa Barbara (UCSB), National Television Violence Study, Executive Summary, Volume Children And TV Violence 2008

21 Longitudinal Relations Between Children’s Exposure to TV Violence and Their Aggressive and Violent Behavior in Young Adulthood: 1977–1992 L. Rowell Huesmann, Jessica Moise-Titus, Cheryl-Lynn Podolski, and Leonard D. Eron University of Michigan Developmental Psychology 2003 The American Psychological Association, Inc. 2003, Vol. 39, No. 2, 201–221 ABSTRACT Although the relation between TV-violence viewing and aggression in childhood has been clearly demonstrated, only a few studies have examined this relation from childhood to adulthood, and these studies of children growing up in the 1960s reported significant relations only for boys. The current study examines the longitudinal relations between TV-violence viewing at ages 6 to 10 and adult aggressive behavior about 15 years later for a sample growing up in the 1970s and 1980s. Follow-up archival data (N 450) and interview data (N 329) reveal that childhood exposure to media violence predicts young adult aggressive behavior for both males and females. Identification with aggressive TV characters and perceived realism of TV violence also predict later aggression. These relations persist even when the effects of socioeconomic status, intellectual ability, and a variety of parenting factors are controlled.

22 Forensic DNA Testing is like CSI! Just ingNothing

23 Forensic Science: the application of natural sciences to matters of the law.

24 Physical Evidence Analysis Is concerned with the recognition, identification, comparison, individualization, interpretation and reconstruction of evidence.

25 Criminalistics: Study and evaluation of the recognition, identification, individualization, and evaluation of physical evidence using the methods of the natural sciences in matters of legal significance.

26 Physical evidence examination can:  Link a suspect with the victim  Link a person to a crime scene  Link an object to a crime  Disprove or support witness testimony  Identify a person  Aid in the Reconstruction of a crime

27 Chain of Custody The chain of custody begins when the evidence is located at the scene even before it is collected and does not end, until the case has been adjudicated in court and all appeals have been exhausted.

28 Forensic Science Lab Services Criminalistics Forensic Biology Serology DNA Trace Analysis Chemistry Instrumentation Identification  Latent Print Section  Questioned Documents  Imprints  Firearms  Toolmarks  Forensic Photography *Crime Scene Reconstruction

29 How Does DNA Forensic Testing Help Help an Investigation? By Providing Important Linkages:  Link suspect to victim  Link suspect to scene  Link victim to scene

30 Forensic DNA Evidence Circumstantial Evidence Was a person there? Patterns

31 Patterns?

32 Patterns are the basis of DNA Identification DNA Profiles, Marker D10S28 C V D E 1 E 2 E 3 C C V D E 1 E 2 E 3 C C = Control V = Victim D = Defendant E = Evidentiary sample Patterns in DNA markers can link a suspect to a crime scene

33

34 Issues in Biotechnology If you flip a coin six times and get heads on all six flips, what is the probability of getting heads on the next toss? (A) 1/2 (B) 1/100 (C) 1/1000 (D) 1/10,000 (E) 1/1,000,000

35 Murder at Rodman Dam, 1988 In July 1987 Randall Scott Jones and Chris Reesh, both in their teens, went target shooting with a 30/30 hunting rifle at the Rodman Dam Recreation Area in Florida. While they were shooting, Jones’ pickup truck became stuck in a sand pit. A fisherman suggested they ask a couple in a pickup parked nearby for help. Jones and Reesh approached the truck, where Kelly Lynn Perry and her fiancé Matthew Brock were sleeping. The two men debated whether or not to wake them to ask for assistance.

36 Murder at Rodman Dam, 1988 The following morning, fishermen found the bodies of Perry and Brock in the woods adjacent to the recreation area. Police investigation revealed that they had been shot with a 30 caliber bullet and Perry had been sexually assaulted. Their pickup was reported stolen.

37 Murder at Rodman Dam, 1988 In August, Jones was arrested in Mississippi, found driving Brocks pickup. Reesh was arrested the next day in Palatka, Florida, after Jones told police that they were together that night in July. Both were indicted on counts of first degree assault and sexual battery.

38 Murder at Rodman Dam, 1988 A semen sample E(vs) retrieved from Perry’s body, and blood samples from Reesh, S1, and Jones, S2, were compared at a laboratory that specialized in DNA testing. The resulting DNA evidence indicated which man was guilty of rape.

39 Murder at Rodman Dam, 1988 DNA results Who is most likely guilty of the rape? A. Chris Reesh B. Randall Jones

40 Using the DNA results and other evidence, officials identified Jones as the rapist and were able to piece together the events of the crime. Without waking the couple in the pickup, Jones shot both Perry and Brock in the head at close range. He and Reesh then dragged the bodies into the woods nearby. They towed Jones’ truck with Brock’s pickup and left with both trucks. Later, Jones returned to the crime scene, moved the bodies further into the woods, and raped Perry. Murder at Rodman Dam, 1988

41 A representative from the DNA lab testified that the chance of another person having the same DNA fingerprint as Jones was one in 9,390,000,000, about twice the earth’s population. After deliberating only 15 minutes, the jury convicted Jones of murder and rape. The judge sentenced him to a double death sentence, making this the first case involving DNA evidence in the U.S. legal history in which the death sentence was handed down. Reesh was sentenced to six years in prison and twenty years probation. Murder at Rodman Dam, 1988

42 Uses for DNA Analysis  Criminal Investigations  Paternity Cases  Genetic Disease Diagnosis  Identifying Endangered Animals  Identifying Remains from War  Identifying Accident Victims DNA

43

44 Hereditary material of all living organisms Found predominantly in the cell nucleus Organized into chromosomes Humans-46 chromosomes 23 maternal & 23 paternal Polymer-individual units called nucleotides Structure-double helix Watson and Crick, 1953 DNA

45 Forensic Identification: Basic Principles  Each of us is genetically unique  If enough genetic variation is tested, each of us can be uniquely identified  DNA is found in nearly all cells (blood, semen, hair, etc.)  DNA from an evidentiary sample can be matched with DNA from a suspect to implicate or exonerate

46 DNA Casework 1. Forensic Analysis (Criminal) 132 labs conducting DNA analysis in 49 states ~ 40,000 cases/year received ~ 25,000 analyzed ~ 80% sexual assaults 2. ~ 30% of the time the suspect is excluded by DNA 3. ~ 300,000 paternity cases per year

47 Sources of Biological Evidence Blood Semen Saliva Urine Hair Teeth Bone Tissue

48 Other Possible items for DNA Testing: 1. cigarette butts 2. gloves, bandanas, ski masks, baseball caps general clothing 3. condoms (inside vs. outside) 4. stains on furniture, pillows, sheets 5. hair clips, lipsticks 6. letters, envelopes, and stamps 7. plant and animal sources of evidence

49 PCR

50 Electro refers to the energy of electricity. Phoresis, from the Greek verb phoros, means “to carry across.” Thus, gel electrophoresis refers to the technique in which molecules are forced across a span of gel, motivated by an electrical current. Gel Electrophoresis: the separation of molecules, DNA, RNA and proteins by charge and size

51 Tools of the Trade The eppendorf tube and the pipetman are the standard stock and trade in the daily work of a molecular biologist

52 What is a Gel?

53 Agarose is a long chain of sugar molecules, a polymer, derived from algae used in electrophoresis to separate molecules Two types of gel: Agarose (horizontal type) Polyacrylamide (vertical type)

54 How are Gels Loaded and Run?

55 Applications of Gel Electrophoresis DNA Fingerprinting DNA Recombinant Technology Forensics The Human Genome Project

56 DNA carries a net negative charge; it is negatively charged because the phosphates (red circles) that form the sugar-phosphate backbone of a DNA molecule have a negative charge.

57 The gel matrix acts as a sieve for DNA molecules. Large molecules have difficulty getting through the holes in the matrix. Small molecules move easily through the holes. Because of this, large fragments will lag behind small fragments as DNA migrates through the gel.

58 As the separation process continues, the separation between the larger and smaller fragments increases.

59 Molecular weight markers are often electrophoresed with DNA. Molecular weight markers are usually a mixture of DNAs with known molecular weights. Molecular weight markers are used to estimate the sizes of DNA fragments in a DNA sample.

60 What are some of the DNA technologies used in forensic investigations? Restriction Fragment Length Polymorphism (RFLP) PCR Analysis STR Analysis Mitochondrial DNA Analysis Y-Chromosome Analysis

61 Restriction Fragment Length Polymorphism (RFLP) RFLP is a technique for analyzing the variable lengths of DNA fragments that result from digesting a DNA sample with a special kind of enzyme. This enzyme, a restriction endonuclease, cuts DNA at a specific sequence pattern know as a restriction endonuclease recognition site. The presence or absence of certain recognition sites in a DNA sample generates variable lengths of DNA fragments, which are separated using gel electrophoresis. They are then hybridized with DNA probes that bind to a complementary DNA sequence in the sample. RFLP is one of the original applications of DNA analysis to forensic investigation. With the development of newer, more efficient DNA-analysis techniques, RFLP is not used as much as it once was because it requires relatively large amounts of DNA. In addition, samples degraded by environmental factors, such as dirt or mold, do not work well with RFLP.

62 PCR Analysis PCR (polymerase chain reaction) is used to make millions of exact copies of DNA from a biological sample. DNA amplification with PCR allows DNA analysis on biological samples as small as a few skin cells. With RFLP, DNA samples would have to be about the size of a quarter. The ability of PCR to amplify such tiny quantities of DNA enables even highly degraded samples to be analyzed. Great care, however, must be taken to prevent contamination with other biological materials during the identifying, collecting, and preserving of a sample.

63 STR Analysis Short tandem repeat (STR) technology is used to evaluate specific regions (loci) within nuclear DNA. Variability in STR regions can be used to distinguish one DNA profile from another. The Federal Bureau of Investigation (FBI) uses a standard set of 13 specific STR regions for CODIS. CODIS is a software program that operates local, state, and national databases of DNA profiles from convicted offenders, unsolved crime scene evidence, and missing persons. The odds that two individuals will have the same 13-loci DNA profile is about one in one billion.

64 Mitochondrial DNA Analysis Mitochondrial DNA analysis (mtDNA) can be used to examine the DNA from samples that cannot be analyzed by RFLP or STR. Nuclear DNA must be extracted from samples for use in RFLP, PCR, and STR; however, mtDNA analysis uses DNA extracted from another cellular organelle called a mitochondrion. While older biological samples that lack nucleated cellular material, such as hair, bones, and teeth, cannot be analyzed with STR and RFLP, they can be analyzed with mtDNA. In the investigation of cases that have gone unsolved for many years, mtDNA is extremely valuable. All mothers have the same mitochondrial DNA as their daughters. This is because the mitochondria of each new embryo comes from the mother’s egg cell. The father’s sperm contributes only nuclear DNA. Comparing the mtDNA profile of unidentified remains with the profile of a potential maternal relative can be an important technique in missing person investigations.

65 Y-Chromosome Analysis The Y chromosome is passed directly from father to son, so the analysis of genetic markers on the Y chromosome is especially useful for tracing relationships among males or for analyzing biological evidence involving multiple male contributors.

66 PCR The Polymerase Chain Reaction Let’s Take a Break

67 PCR The Polymerase Chain Reaction

68 Repetition of this cycle will cause repeated replication of the target

69  THERE ARE MILLIONS OF DIFFERENT GENES OR SEQUENCES WITHIN ANY DNA SAMPLE (BLOOD, TISSUE, PLANT, ETC.).  A SPECIFIC SEQUENCE IS SELECTED TO BE AMPLIFIED (RED ABOVE). THIS SEQUENCE CAN BE ANY GENE OF INTEREST OR A NON-CODING MARKER REGION OF DNA.

70 IN ORDER TO COPY THE SEQUENCE OR GENE, A SHORT SEQUENCE ON EITHER SIDE OF THE SECTION MUST BE KNOWN. THIS REGION (BLUE ABOVE) WILL SERVE AS A PRIMER ATTACHMENT SITE TO COPY THE DNA TARGET SEGMENT.

71 IN ORDER TO AMPLIFY A SPECIFIC FRAGMENT OF DNA, SEVERAL THINGS ARE NEEDED, INCLUDING PRIMERS AND DNA POLYMERASE. AN ENZYME WHICH COPIES DNA, PRIMERS ARE SHORT PIECES OF DNA OR RNA DESIGNED TO PAIR WITH GENOMIC DNA AT A SPECIFIC ATTACHMENT SITE FOR THE MAIN PURPOSE OF HELPING THE DNA POLYMERASE BIND AT THE DESIRED SECTION.

72 WITHOUT A SHORT PIECE OF DNA(OR RNA) TO ATTACH TO, DNA POLYMERASE CAN NOT COPY A DNA STRAND.

73 NUCLEOSIDE TRIPHOSPHATES, THE BUILDING BLOCKS OF DNA ARE ALSO NEEDED. EACH NUCLEOSIDE TRIPHOSPHATE CONSISTS OF:  A BASE (ADENINE, THYMINE, CYTOSINE OR GUANINE).  A SUGAR AND THREE PHOSPHATES.

74 PCR REQUIRES SEVERAL CYCLES OF AMPLIFICATION. EACH CYCLE CONSISTS OF THREE TEMPERATURE CHANGES.  THE STARTING TEMPERATURE (95 C) SEPARATES THE DNA STRANDS.  A LOWERED TEMPERATURE (50-60 C) ALLOWS PRIMERS TO BIND TO COMPLEMENTARY SEQUENCES IN THE DNA.  A SLIGHTLY HIGHER TEMPERATURE (72 C) ALLOWS DNA POLYMERASE TO ATTACH TO THE PRIMERS AND COPY THE DNA STRANDS (EXTENSION).

75 DNA STRANDS ARE SEPARATED BY 94 o C.

76 THE TEMPERATURE IS LOWERED TO 54 o C TO ALLOW PRIMERS TO PAIR WITH COMPLEMENTARY DNA SEQUENCES.

77 MAKING NEW DNA MOLECULES:  DNA POLYMERASE ATTACHES TO THE 72 C.  DNA POLYMERASE ADDS NUCLEOSIDE TRIPHOSPHATES TO THE PRIMERS TO COPY THE DNA STRANDS.

78 COPYING IS COMPLETED FOR EACH STRAND.

79 THE PROCESS IS REPEATED IN THE NEXT CYCLE. THE TEMPERATURE IS RAISED AGAIN TO SEPARATE THE DNA STRANDS.

80 THE TEMPERATURE IS LOWERED TO ALLOW PRIMERS TO ANNEAL. DNA POLYMERASE ATTACHES TO THE PRIMERS AND DNA IS COPIED TO MAKE 4 STRANDS OF DNA.

81 ...atatatacaacttactaccatata ccgattacgatcgaattataccgcgga cgtagtaatgacgatgaagtaactata tatatatatatatatatatatatatatatatatatat atatatatatatatatatatatatatatatatatat atatatatatatatatatatatatatatatatatat atatatatatatatatatatatatatatatatatat atatatatatatatatatatatatatatatatatat atatatat atactacctaccagggaggagata... “Short Tandem Repeat sequence” STRs Are Used in Identity Testing

82 CODIS 13 Core STR Loci with Human Chromosomal Positions CSF1PO D5S818 D21S11 TH01 TPOX D13S317 D7S820 D16S539D18S51 D8S1179 D3S1358 FGA VWA AMEL

83 THE PROCESS OF COPYING DNA STRANDS IS REPEATED TIMES. WITH EACH AMPLIFICATION CYCLE, THE NUMBER OF COPIES OF THE DNA SEQUENCE IS DOUBLED UNTIL MILLIONS OF COPIES HAVE BEEN MADE.

84 Over 1 million copies are generated in 32 cycles of this chain reaction These copies can easily be detected by gel electrophoresis. The size of the DNA fragment should be that of the target sequence

85 What is CODIS? Combined DNA Index System CODIS is a computer software program that operates local, State, and national databases of DNA profiles from convicted offenders, unsolved crime scene evidence, and missing persons. Every State in the Nation has a statutory provision for the establishment of a DNA database that allows for the collection of DNA profiles from offenders convicted of particular crimes. CODIS software enables State, local, and national law enforcement crime laboratories to compare DNA profiles electronically, thereby linking serial crimes to each other and identifying suspects by matching DNA profiles from crime scenes with profiles from convicted offenders. The success of CODIS is demonstrated by the thousands of matches that have linked serial cases to each other and cases that have been solved by matching crime scene evidence to known convicted offenders. The missing persons index consists of the unidentified persons index and the reference index. The unidentified persons index contains DNA profiles from recovered remains, such as bone, teeth, or hair. The reference index contains DNA profiles from related individuals of missing persons so that they can be periodically compared to the unidentified persons index. All samples for this index are typed using mtDNA and STR DNA analysis (if possible) to maximize the power of advancing technology.

86 In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created PCR Copies DNA Exponentially through Multiple Thermal Cycles Original DNA target region Thermal cycle

87 Laboratory PCR Instrument INPUT: Sample DNA, PCR enzymes, primers, individual nucleotide building blocks (and maybe fluorescent labels) OUTPUT: Specific DNA fragments amplified millions of times for easy visualization With sizes that vary between individuals

88 Multiplex PCR Over 10 Markers Can Be Copied at Once Sensitivities to Levels Less Than 1 ng of DNA Ability to Handle Mixtures and Degraded Samples Different Fluorescent Dyes Used to Distinguish STR Alleles with Overlapping Size Ranges

89 Available Kits for STR Analysis Kits make it easy for labs to just add DNA samples to a pre-made mix 13 CODIS core loci –Profiler Plus and COfiler (PE Applied Biosystems) –PowerPlex 1.1 and 2.1 (Promega Corporation) Increased power of discrimination –CTT (1994): 1 in 410 –SGM Plus™ (1999): 1 in 3 trillion –PowerPlex ™ 16 (2000): 1 in 2 x 10 17

90 Analysis of four different sections of the DNA Identity Testing Using PCR Possible conclusions: A. Suspect 1 DNA was at the scene B. Suspect 2 DNA was at the scene C. Suspect 3 DNA was at the scene D. None were at the scene E. Multiple suspects were at the scene F. Data is inconclusive S = size standards V = victim’s DNA 1 = suspect #1 blood 2 = suspect #2 blood 3 = suspect #3 blood E = evidence #1 S = size standards

91 S V E S A complete match! S = size standards V = victim’s DNA 1 = suspect #1 blood 2 = suspect #2 blood 3 = suspect #3 blood E = evidence #1 S = size standards

92 Case Study: State vs. Michael DeCorso  Homicide (no DNA)  Rape: DNA in semen samples from two teenage female victims

93 DNA Profiles, Marker D10S28 C = Control V = Victim D = Defendant E = Evidentiary sample Population frequency of defendant’s genotype = 1/50 C V D E 1 E 2 E 3 C C V D E 1 E 2 E 3 C

94 DNA Profiles, Marker D4S139 C = Control V = Victim D = Defendant E = Evidentiary sample Population frequency of defendant’s genotype = 1/90 C V D E 1 E 2 E 3 C C V D E 1 E 2 E 3 C

95 DNA Profiles, Marker D5S110 C = Control V = Victim D = Defendant E = Evidentiary sample Population frequency of defendant’s genotype = 1/10 C V D E 1 E 2 E 3 C C V D E 1 E 2 E 3 C

96 DNA Profiles, Marker TH01 C = Control V = Victim D = Defendant E = Evidentiary sample Population frequency of defendant’s genotype = 1/70 C V D E 1 E 2 E 3 C C V D E 1 E 2 E 3 C

97 The information from each gel can be combined to tell us how common the DNA profile is in the general population 1/50 x 1/90 x 1/10 x 1/70= 1/3,150,000 1/50 x 1/90 x 1/10 x 1/70 = 1/3,150,000

98 Random match probabilities CODIS with 13 Markers - Probability of an identical match greater than all the people who have ever been born in the history of the earth

99 Forensic applications of DNA based technologies Fingerprinting OJ Simpson Identification Paternity Crime Solving World wide data base

100 Dramatic Growth In DNA-Based Forensics Doesn’t Translate Into Very Many Job Opportunities

101 One set of 22 autosomes (plus X) One set of 22 autosomes (plus X or Y) Three children: The father claims he is not the father of the third child Note: There are two alleles* for each genetic marker Paternity Testing

102 1994 HOMICIDE PLASTIC BAG FOUND IN SHALLOW GRAVE WITH BLOODY JACKET AND TRACE HAIRS HAIRS BELONGED TO SUSPECT’S CAT, SNOWBALL USE OF NON-HUMAN DNA PERFECT DNA MATCH WITH CAT STRS (NY TIMES INTERNATIONAL APRIL 24, 1997)

103 DOG DNA CONTRIBUTES TO MURDER CONVICTIONS SEATTLE, DOUBLE MURDER, 2 SUSPECTS COUPLE TORTURED AND SHOT ALONG WITH PET DOG DID BLOOD ON SUSPECT’S CLOTHING MATCH THE DOG? 1 IN 3 BILLION MATCH PROBABILITY IN RANDOM CANINE POPULATION

104 FORENSIC PLANT DNA DNA MARKERS FOR PLANTS CAN BE USED TO LINK EVIDENCE TO A CRIME SCENE GRASS STAINS LINKED TO LAWNS VEGTABLE DNA LINKED TO RESTAURANTS RARE OR UNUSUAL PLANTS LINKED TO VEHICLES MARAJUANA

105 The CT CODIS Database collects two types of samples; (1) Convicted Offender Samples that include all Felony Convictions (since 03/01/04) and, (2) Forensic Unknowns that include any DNA profile from an evidentiary sample that does not match the victim or an elimination known. There are currently 10,793 offenders in CT Database and over 1,500 offender samples are added per month. Currently there are how many felons on the CT database? (A) 1 out of 50 males in CT (B) 1 out of 500 males in CT (B) 1 out of 1000 males in CT (C) 1 out of 10,000 males in CT (E) none of these answers is correct

106 CASE STUDY

107 Renee Pellegrino

108 Renee Pellegrino’s found June 25, 1997, murder victim. Renee Pellegrino was an accomplished scholar with a law degree, had become addicted to crack cocaine and turned to prostitution. She was 40 years old and pregnant when her naked body was discovered in a cul-de-sac off Waterford Parkway South, CT. Renee Pellegrino

109 She had just been released from a three-week prison stay when she was apparently picked up by her killer in downtown New London on June 25, 1997, murdered and left naked on Parkway South. She had been strangled, and the killer had left her body in what the judge described as an “extreme” manner. Renee Pellegrino

110 Cold Case

111 Dickie Anderson 2012 Charged Police make arrest in Pellegrino cold case June 1, years later Police charged Dickie E. Anderson Jr., 40, with murder in the 41-year-old Pellegrino’s death. The arrest was the result of a cold-case investigation into Pellegrino’s death, which occurred on a dead-end street in Waterford. The state Office of the Chief Medical Examiner ruled that Pellegrino had been strangled. Anderson, who was 27 at the time of the crime, was arrested as a result of an investigation conducted by the Southeastern Connecticut Cold Case Unit. The arrest warrant has been sealed.

112 Dickie Anderson 2012 Charged Police make arrest in Pellegrino cold case June 1, 2010

113 Dickie Anderson 2012 Charged Police make arrest in Pellegrino cold case June 1, 2010 Police used a combination of evidence to build the case against the man accused in the 1997 murder of Renee Pellegrino, including DNA, inconsistent statements Dickie E. Anderson Jr. made to police over the years and his own admission that he was with Pellegrino shortly before her body was discovered in Waterford.

114 Dickie Anderson 2012 Over 13 years a case was built using DNA, inconsistent statements Anderson had made, and his admission that he was with Pellegrino shortly before her body was discovered in a cul-de-sac off Parkway South, CT.

115 This is not a trick question “If you had to vote right now in this case, guilty or not guilty, what would you vote?” Dickie Anderson 2012 (A) guilty (B) not guilty (C) can’t vote; I don’t know the facts of the case

116 Dickie Anderson 2012 This is a common question during jury selection, and many people are tempted to respond, incorrectly, that they can’t vote because they don’t know the facts of the case. The correct answer, as supplied by a woman in New London, CT who was eventually selected to serve on the panel, is “not guilty.” This is not a trick question “If you had to vote right now in this case, guilty or not guilty, what would you vote?”

117 Dickie Anderson 2012 In a second case against, police charged Anderson with killing 29-year-old Michelle Comeau of Norwich in Anderson was previously charged with the murder of Renee Pellegrino. The Comeau case did not involve DNA. Both of the women had been working as prostitutes and were victims of strangulation. Police found Comeau’s body dumped along an access road to the Norwich Industrial Park near Dodd Stadium in May, Anderson has acknowledged he knew both victims. He told police he had been with Pellegrino on the night she disappeared from downtown New London.

118 Dickie Anderson 2012 Pellegrino had been strangled, and her killer had posed her naked body. In May 1998, police found Comeau’s body dumped along an access road to the Norwich Industrial Park near the Norwich-Franklin town line. She too had been strangled. The state claims her killer was in the process of posing her naked body in a similar manner but was interrupted and left the scene. Anderson’s DNA was found on Pellegrino's body, but there is no DNA evidence to link him to the Comeau case. He knew both women and admitted to having sex with them on the day they were killed.

119 Dickie Anderson 2012 One inmate reported that Anderson admitted to killing “Renee” and said several times that he would have never done it if he had known Pellegrino was pregnant. She was 17 weeks pregnant when she died, according to the state Office of the Chief Medical Examiner. Police also spoke with former girlfriends of Anderson who told them he was rough during sex. One woman said Anderson threatened her and said he had gotten away with killing somebody. The woman said Anderson said he fought with a prostitute who kept asking him for money, and that he hit and killed the girl in Bates Woods in New London..

120 Dickie Anderson 2012 The police also interviewed a girlfriend who broke up with Anderson in She recalled that twice Anderson choked her so hard he left red marks on her neck, the warrant says. She turned over to police a picture of her injuries that she said a friend had taken. Another former girlfriend, whom Anderson was convicted of strangling in 2008, said the two had argued about her getting a job and that Anderson threw her to the floor and began choking her. She said if police did not break into the apartment and physically remove Anderson from her, she thinks she would have died..

121 Dickie Anderson 2012 Dickie Anderson Jr., a self-confessed “trick artist” who told police he often traded crack cocaine for sex with prostitutes, was connected by witnesses to both of the women he is accused of killing. In 2008, the state forensic laboratory had notified police that DNA taken from Pellegrino’s body matched a DNA sample that had been taken from Anderson. The laboratory also found DNA on Pellegrino from an unknown source.

122 Anderson’s previous convictions include: Jan. 2007, third-degree assault November 2005, violation of a protective order September 2005, second-degree failure to appear in court, second-degree threatening, second-degree criminal mischief May 2003, violation of probation, evading responsibility, second-degree failure to appear in court, third-degree assault July 2002, interfering with a police officer March 1999, second-degree assault Dickie Anderson 2012

123

124 This is not a trick question “If you had to vote right now in this case, guilty or not guilty, what would you vote?” (A) guilty (B) not guilty (C) can’t vote; I don’t know the facts of the case Dickie Anderson 2012

125

126 Anderson convicted of one of two murders Jury decides he killed Pellegrino in Waterford cold case; mistrial declared in deadlock over second prostitute murder Dickie Anderson 2012

127 The Death Penalty

128 STATES WITH THE DEATH PENALTY Alabama Arizona Arkansas California Colorado Delaware Florida Georgia Idaho Indiana Kansas Kentucky Louisiana Maryland Mississippi Missouri Montana Nebraska Nevada New Hampshire North Carolina Ohio Oklahoma Oregon Pennsylvania South Carolina South Dakota Tennessee Texas Utah Virginia Washington Wyoming ALSO - U.S. Gov't - U.S. Military STATES WITHOUT THE DEATH PENALTY (YEAR ABOLISHED IN PARENTHESES) Alaska (1957) Connecticut** (2012) Hawaii (1957) Illinois (2011) Iowa (1965) Maine (1887) Massachusetts (1984) Michigan (1846) Minnesota (1911) New Jersey (2007) New Mexico* (2009) New York (2007)# North Dakota (1973) Rhode Island (1984)*** Vermont (1964) West Virginia (1965) Wisconsin (1853) ALSO Dist. of Columbia (1981) States With and Without the Death Penalty 2012

129 The Death Penalty Capital punishment in Rhode Island

130 The Cheshire, Connecticut, home invasion murders occurred on July 23, 2007, when a mother and her two daughters were murdered during a home invasion in Cheshire, Connecticut. The Hartford Courant referred to the case as “possibly the most widely publicized crime in the state’s history.” In 2010, Steven Hayes was convicted of the murders and sentenced to death. His accomplice, Joshua Komisarjevsky, was found guilty on October 13, 2011, and sentenced to death on January 27, In the late afternoon of July 22, 2007, Jennifer Petit and her daughter Michaela went to a local grocery store in Cheshire. They picked up food for the evening meal which would be prepared by Michaela. They, along with Jennifer’s other daughter Hayley, would be killed several hours later in a home invasion.

131 As Jennifer Hawke-Petit and 11-year-old Michaela Petit shopped at a local supermarket, unbeknownst to them, they had been targeted by Komisarjevsky, who followed them home, and planned to later rob the family by home invasion. Anticipating their deeds, Hayes and Komisarjevsky exchanged text messages that were later introduced in court. Hayes first messaged Komisarjevsky: “I'm chomping at the bit to get started. Need a margarita soon”. Hayes then texts: “We still on?” Komisarjevsky replies “Yes”. Hayes’ next text asks, “Soon?”, to which Komisarjevsky replied with “I’m putting the kid to bed hold your horses”. Hayes then asserts “Dude, the horses want to get loose. LOL”. According to Hayes’ confession, the two men planned to rob the house and flee the scene with the family bound and unharmed. Hayes attributed the outcome of the spree to a change in their plan. Upon their early morning arrival, they found William Petit sleeping on a couch on the porch. With a bat Komisarjevsky had found in the yard, he bludgeoned William and then restrained him in the basement at gun point. The children and their mother were each bound and locked in their respective rooms. Hayes says he and Komisarjevsky were not satisfied with their haul, and that a bankbook was found which had an available balance. Hayes convinced Jennifer to withdraw $15,000 from her line of credit. A gas station’s video surveillance shows Hayes purchasing $10 worth of gasoline in two cans he had taken from the Petit home. After returning to the house, and unloading the gas, he took her to the bank. The prosecution later entered this as evidence of premeditation. Home invasion

132 The bank surveillance cameras captured the transaction which shows Hawke-Petit in the morning of July 23 as she informed the teller of her situation. The teller then called 911 and reported the details to police. Hawke-Petit left the bank, was picked up by Hayes, who had escorted her there, and drove away. These actions were reported to the 911 dispatcher and recorded in real time. The teller stated that Hawke-Petit had indicated the assailants were “being nice”, and she believed they only wanted money. The Cheshire police response to the bank tellers “urgent bid” began with assessing the situation and setting up a vehicle perimeter. These preliminary measures employed by the police exhausted more than half an hour and provided the time used by the assailants to conclude their modified plan. Home invasion

133 During this time, Hayes and Komisarjevsky escalated the aggravated nature of their crimes. Komisarjevsky sexually assaulted the 11-year-old daughter, Michaela. Komisarjevsky, who had photographed the sexual assault of the youth on his cell phone, then provoked Hayes to rape Hawke-Petit. While Hayes was raping Hawke-Petit on the floor of her living room, Komisarjevsky entered the room announcing that William Petit had escaped. Hayes then strangled Hawke- Petit, doused her lifeless body and parts of the house including the daughters rooms with gasoline. The daughters, while tied to their beds, had both been doused with gasoline; each had her head covered with a pillowcase. A fire was then ignited, and Hayes and Komisarjevsky fled the scene. 17-year-old Hayley and 11- year-old Michaela both died from smoke inhalation. Home invasion

134 William Petit had been able to free himself, escape his confines, and call to a neighbor for help. The neighbor indicated that he did not recognize Petit, due to the severity of Petit’s injuries. In court testimony, William Petit stated that he felt a “jolt of adrenaline” coupled with a need to escape upon hearing one of the perpetrators state: “Don’t worry, it’s going to be all over in a couple of minutes”. Petit then told the jury, “I thought, it’s now or never because in my mind at that moment, I thought they were going to shoot all of us”. Hayes and Komisarjevsky fled the scene using the Petit family car. They were immediately spotted by police surveillance, pursued by police, apprehended, and arrested one block away. The whole invasion lasted seven hours. The scenario was revealed in a confession by Hayes just hours after the killings. Detectives testified that Hayes exuded a strong stench of gasoline throughout the interrogation. Each perpetrator was said to have blamed or implicated the other as the mastermind and driving force behind the spree. There were even attempts to blame William Petit as an accomplice. A diary kept by Komisarjevsky was entered into evidence which also blamed William. This account called him a “coward” and claimed he could have stopped the murders had he wanted to. Home invasion

135 Joshua A. Komisarjevsky Born( ) August 10, 1980 (age 31) Conviction(s) Capital felony, murder, sexual assault, kidnapping, and arson PenaltyDeath sentence Status Convicted of 17 out of 17 charges, including 6 capital felonies

136 Steven J. Hayes Born ( ) May 30, 1963 (age 49) Homestead, Florida, U.S. Conviction(s)Capital felony, murder, sexual assault Penalty Six consecutive death sentences plus 106 years Status Convicted on 16 counts; sentenced to death on six counts of capital felony ChildrenA son and a daughter

137 The Death Penalty

138 (A) for (B) against The Death Penalty

139 The Hollow Men T. S. Eliot Mistah Kurtz—he dead. A penny for the Old Guy I. We are the hollow men We are the stuffed men Leaning together Headpiece filled with straw. Alas! Our dried voices, when We whisper together Are quiet and meaningless As wind in dry grass Or rats’ feet over broken glass In our dry cellar Shape without form, shade without colour, Paralyzed force, gesture without motion; Those who have crossed With direct eyes, to death’s other Kingdom Remember us—if at all—not as lost Violent souls, but only As the hollow men The stuffed men.

140 1. Who recognizes, identifies, individualizes and evaluates physical evidence using the methods of natural sciences in matters of legal significance? (A) detectives (B) criminologists (C) criminalists (D) criminals (E) local police

141 2. The CT CODIS Database collects two types of samples; (1) Convicted Offender Samples that include all Felony Convictions (since 03/01/04) and, (2) Forensic Unknowns that include any DNA profile from an evidentiary sample that does not match the victim or an elimination known. There are currently 10,793 offenders in CT Database and over 1,500 offender samples are added per month. Currently there are how many felons on the CT database? (A) 1 out of 50 males in CT (B) 1 out of 100 males in CT (C) 1 out of 1,000 males in CT (D) 1 out of 10,000 males in CT (E) none of these answers is correct

142 3. CODIS stands for: (A) combined DNA Index System (B) combinatorial Operations for DNA Identification Systems (C) criminalists for DNA Indexing Systems (D) none of these answers are correct

143 4. PCR is used in plant genetics, animal cloning, drug discovery, cancer research and forensics. (A) false (B) true (C) only when a plant geneticist thinks his collaborator stole his work (D) only when forensic analysis involves plant material from a crime scene

144 5. DNA analysis is now a common and widely accepted forensic tool used to analyze evidentiary DNA. (A) true (B) false (C) only in less than half the states (D) only used on convicted felons

145 6. In the national debate about the use of forensic DNA analysis and the building of DNA databases (such as an all felon database vs. an all arrestee database of a general public database) there are two competing views. One view holds that DNA testing and the building of databases is a matter of public safety: DNA solves crimes; only criminals should fear DNA testing or databases. The opposing view holds that: (A) there are privacy concerns, maintaining that DNA information is different where there is significant potential for abuse (B) misused DNA evidence has obviously exonerated guilty people citing the OJ Simpson trial, no one is looking for the criminal of that crime (C) that the PCR approach to DNA testing is not accurate or reliable (D) DNA databases will be far too costly to maintain or use

146 7. Considering the National debate on DNA forensic databases which of the following is not an issue? (A) constitutionality of taking DNA samples from arrestees and suspects (B) practical/financial considerations of expanding DNA databanks (C) what happens to the sample after profiling? (D) post-conviction DNA testing. >150 exonerated-August 2004 (E) accuracy of the DNA testing protocols

147 8. (STR) technology is used to evaluate specific regions (loci) within nuclear DNA. Variability in STR regions can be used to distinguish one DNA profile from another. The Federal Bureau of Investigation (FBI) uses a standard set of 13 specific STR regions for CODIS. CODIS is a software program that operates local, state, and national databases of DNA profiles from convicted offenders, unsolved crime scene evidence, and missing persons. The odds that two individuals will have the same 13-loci DNA profile is extremely unlikely. STR stands for: (A) Standard Temperature Reactions (B) Statewide Tracking Reliabilities (C) Short Tandem Repeats (D) Starwars Tracking Reactions

148 9. There was a homicide in A plastic bag was found in the shallow grave of the victim with a bloody jacket and some trace hairs were recovered. What techniques would be best used to match the hairs to the suspect’s cat, snowball? (A) PCR providing a perfect match with cat STRs (B) all of these techniques together provide the best case (C) PCR of the blood from the jacket to tie the DNA of the suspect to the jacket (D) scanning electron microscopy of the trace evidence showed that they were those of a cat

149 10. Research on how the principles of biology and evolution are involved with criminal behavior is in its infancy. The principal mechanism of evolution, which includes two processes that operate together: chance variability and selection, is called: (A) natural selection (B) ingenuity (C) conjugation (D) predation (E) intelligent design

150 11. DNA databases are controversial because: (A) because of the conflict between public safety and civil liberties (B) they have not proven useful to solving crimes (C) they use crime genes to evaluate unsuspected criminals from the pubic (D) they have been too expensive or computationally too difficult to manage on a large scale

151 12. There was a double murder in Seattle in 1996 and preliminary investigation came up with two suspects. A couple had been tortured and shot dead along with their pet dog. There was blood on one of the suspect’s clothing. The blood on the clothing could be best matched with that of the dog by doing what? (A) looking for matching dogs hairs at the crime scene (B) finding no dog blood on the second suspect (C) using PCR on both samples with known molecular makers for dogs (D) obtaining the records from the local veterinarian

152 13. What are the odds of two people’s DNA matching one another given the nationally used 13 CODIS core of STR loci used by state and federal forensics experts? (A) over 1 in a billion (B) 1 in 3 million (C) 1 in 700,000 (D) 1 in 7,000 (E) less than 1 in 90

153 14. Which of these items could be a source for possible DNA forensic testing: (A) all of these items can be used for DNA testing (B) cigarette butts (C) general clothing: including gloves, bandanas, ski masks, baseball caps (D) condoms (inside vs. outside) (E) a bloody knife

154 15. How does forensic testing help in a criminal investigation? (A) by linking a suspect to a victim (B) by linking a victim to crime scene (C) by linking a suspect to crime scene (D) by any or all of the answers

155 16. You are a prospective juror for a trial which you have read about in you local newspaper. You are asked, “If you had to vote right now in this case, guilty or not guilty, what would you do?” What should be your response according to the law in the United States? (A) guilty (B) not guilty (C) not enough evidence (D) none of these answers

156 17. Renee Pellegrino was an accomplished scholar with a law degree, had become addicted to crack cocaine and turned to prostitution. She was 40 years old and pregnant when her naked body was discovered in a cul-de-sac off Waterford Parkway South, CT. on June 25, 1997 murdered. In 2008, the state forensic laboratory had notified police that DNA taken from Pellegrino’s body matched a DNA sample that had been taken from Dickie Anderson Jr. The DNA evidence: (A) proved that Dickie Anderson was guilty (B) showed that Dickie Anderson was not guilty (C) provided circumstantial evidence that linked Dickie Anderson to the crime (D) not enough evidence (E) none of these answers


Download ppt "© life_edu Lecture 32 Part I. DNA-Based Forensics: The Real Story Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us."

Similar presentations


Ads by Google