Presentation is loading. Please wait.

Presentation is loading. Please wait.

Fall 2014 HORT6033 Molecular Plant Breeding INSTRUCTOR: AINONG SHI HORT6033 web site:

Similar presentations


Presentation on theme: "Fall 2014 HORT6033 Molecular Plant Breeding INSTRUCTOR: AINONG SHI HORT6033 web site:"— Presentation transcript:

1 Fall 2014 HORT6033 Molecular Plant Breeding INSTRUCTOR: AINONG SHI HORT6033 web site:

2 Fall 2014 HORT6033 Molecular Plant Breeding Lecture 5 (09/08/2014) I.Genetic Diversity II.Example III.Homework IV.Questions

3 Genetic diversity refers to any variation in the nucleotides, genes, chromosomes, or whole genomes of organisms. It entails looking at the genetic characteristics in the genetic makeup of a species. It is different from genetic variability, which describes the tendency of genetic characteristics to vary. Genetic diversity serves as a way for populations to adapt to changing environments. With more variation, it is more likely that some individuals in a population will possess variations of alleles that are suited for the environment. Genetic Diversity and Benefit

4 Genetic Diversity in Breeding Select parents for crossing Breeding varieties to fit environments, stress, and consumer demand Genetic structure study and trait association analysis

5 Causes of Genetic Diversity Classification: INTERNAL USE ONLY Gene recommendation Gene mutation Gene transfer Selection

6 Genetic variation between and within species, which is measured by determining the proportion of polymorphic loci across the genome, or by the number of heterozygous individuals in a population. Genetic Diversity Fruit size: large vs small Fruit color: red vs yellow Tomato spotted wilt virus (TSWV): Resistance vs susceptible plant TSWV resistance: Resistance vs susceptible gene Sw-5 vs sw-5 Susceptible plant Resistant plant AY sw5bTAATTTTCTCCTCAACATGTCGGCAAGAACATCAACCGTAGCTCCATTGTCGTCGGAACCTGTAACTTGACTGAAAATATCTTGTAATAACTCTCTCCGA 400 LA A Y-R G M--C-R 400 NY G T-A A T LA G T-A A T DNA sequence diversity SNP variation

7 Plant materials: A total of 413 spinach genotypes were used in this study, including 323 USDA-GRIN germplasm originally collected from 33 countries. DNA extraction: genomic DNA is extracted from spinach leaves using the CTAB. Sequencing: using GBS by HiSeq 2000 in BGI SNP discovery: GBS data analysis using DNASTAR Lasergene Genomics Suite, TASSEL; Around half million SNPs were discovered from the 413 spinach genotypes using GBS by de novo assembly. Genetic Diversity in World-wide Spinach DNA extraction Genotyping by Sequencing SNP Discovery Spinach germplasm Data Analysis Genetic Diversity

8 Genetic diversity: 380 SNPs were used for genetic diversity analysis. The genetic diversity analysis indicated that there was a geography (country) factor during spinach variety development and spinach production. Genetic Diversity in Spinach

9 The above cluster mainly consists of the spinach germplasm from Afghanistan, Iran, China, and India, Iran, and Japan

10 The above cluster mainly consists of the spinach germplasm from Turkey, indicating these turkey germplasm has the similarity genetic background.

11 All UAF spinach lines merged together, indicating The Good: UAF has special spinach germplasm; and The Bad: UAF spinach lines have narrow genetic background. Spinach Lines Developed by UAF Challenge: Continuously develop unique UAF spinach varieties Introgress other spinach genetic background into UAF spinach lines in order to broad genetic diversity

12 SNP_IDSNP short read record_ CAGCAAAAATGAAACCAAGTTTAAGAAATACCCA[A/T]AGTTCTATATTT GAAGAAGAGAAATTTCATAAGATACCTCTTGTATA record_ CAGCCCCATTCTAGAAATATTCATCCTCTACATCTTTAAAGGATGCCT[A/ G]TTCACATCTCCATTCTTATAGTATCCACTTCTG record_ CAGCTTTTAAATCAGCTGAATTTCAACATTCGTAATCTGTTTGT[G/T]TAT TATGTTTAAAGTTGTTTCTACTGATTATTGATGT record_ CAGCCTAAATCAAGTGGTRATGCATTTTCTCCCCT[C/T]TTCTGATTCACT TGAGGAATCTGTTTAGACATAGCTAATTTCATAA record_ CAGCAATTCATTGTTATTTAAGGTATCGTTAAGTGTATTCAACGATTTTT MTAACAAAATAACAAC[A/G]TTAAGGTTCGAGGAT record_ CAGCCTTATTAGGCAAACAAGTC[C/T]CTAGAACAAGATCAATTTGATGT TMAATTCCACGAATAGGAGGCGAACCTGGTGGTAA record_ CAGCTAAAAGATTGGAGTAATAGTCGAATCCTCGAACCTTAA[C/T]GTTG TTATTTTGTTAGAAAAATCKTTGAATACACTTAAC record_ CAGCTCAAATATTAAACCCTTGCTGTTGGGATCTACTGTACTGAAGTAGT AACTCTTCTAAGTAAAAGAATAAGCG[A/G]CTCTA record_ CAGCTGTGAA[A/G]CTGAAATTAGTGTCATTTGATGTTATTGTGTTATTG TGTTAATTTTCAAGTGTTGCCATTAATCAGTTTAC record_ CAGCTCAGCAAAATCTAGCAAAGTGAATGATTTGGATCAGACTTATGATT TTGTAA[A/T]GGGGGACCTTTTTCCCATACATTCC record_ CAGCTGGACCTRGGAAGGGGAACATGCATGTTATCTTTCTAGATGT[C/G ]TTAAAAGTTAAAACAGGTGTGTTAAGCTTACTAAT record_ CAGCAATGGACATGAAGCAGGTCGAAAGACCCACTTTACTTT[A/C]GCT ACAACACGAATATTACCACAATCGAAATTGCGRTTT record_ CAGCATCAGAATCTGTTTATTTCAGTCTAGATAATGTATATCAGCTTATTG CTAGGAACT[C/T]TGATCCCTCAAAGTTCACAAT record_ CAGCAGTCACAGCAACCTTTATGTCCCTGGGATGGAACTGACCGCGATT ATCTGTAT[A/G]AAGAGGTRAGCTGTTTTGATCATC record_ CAGCCACTAGGGCAAGAGCAGAAACT[A/C]CTTGTCCAATACATACATTT TTAATATATAACCATGGTTATTTCATCTTTAGGGG A SNP Set for Spinach Cultivar Identification So far, a SNP set consists of 15 SNPs postulated from genetic diversity analysis, which can distinguish and determine all 413 tested spinach genotypes. (left: 15 SNPs; right: example of spinach using the 15 SNPs)

13 1. Clustal X2 and TreeView X Clustal X2: TreeView X: 2. MEGA 6 Tools for Genetic Diversity Analysis

14 Examples for Sw-5 of Tomato DistanceStevens-Sw5bLA3667_Sw5abLA3433_sw5LA2823_sw5NY07-464_sw5Stevens-Sw5a Stevens-Sw5b0 LA3667_Sw5ab0.000 LA3433_sw LA2823_sw NY07-464_sw Stevens-Sw5a Sw-5 sample data to download

15 Examples for Spinach Fifteen SNP data for spinach variety determination Download the 15 SNP set data Genetic diversity in world wide spinach germplasm Download the 760 SNP data for ww spinach

16 Homework 1.Use Clustal X2 and TreeView X to do genetic diversity for 15 SNP data of spinach lines; 2.Use MEGA 6 to do genetic diversity for 15 SNP data of spinach lines; 3.Use MEGA 6 to do genetic diversity for world wide spinach germplasm


Download ppt "Fall 2014 HORT6033 Molecular Plant Breeding INSTRUCTOR: AINONG SHI HORT6033 web site:"

Similar presentations


Ads by Google