Presentation is loading. Please wait.

Presentation is loading. Please wait.

Fall 2014 HORT6033 Molecular Plant Breeding INSTRUCTOR: AINONG SHI HORT6033 web site:

Similar presentations


Presentation on theme: "Fall 2014 HORT6033 Molecular Plant Breeding INSTRUCTOR: AINONG SHI HORT6033 web site:"— Presentation transcript:

1 Fall 2014 HORT6033 Molecular Plant Breeding INSTRUCTOR: AINONG SHI HORT6033 web site:

2 Fall 2014 HORT6033 Molecular Plant Breeding Lecture 4 (09/03/2014) I.SNP II. SNP discovery by PCR III.Example IV.Homework V.Question

3 Single Nucleotide Polymorphism (SNP) (http://learn.genetics.utah.edu/content/p harma/snips/)http://learn.genetics.utah.edu/content/p harma/snips/ SNP: A single nucleotide (A, T, C or G) mutation Use: genetic and genome mapping, Association studies, Genetic diversity analysis, and Tagging important genes Approach: SNP discovery from PCR SNP discovery from High throughput - Next generation sequencing (NGS) – RNA-Seq, RAD-Seq, GBS etc.

4 SNP Discovery Tool There are dozens of tools for SNP discovery. We will talk below two: BioEdit Download: Manual: DNASTAR Lasergene Genomics Suite Download free TRY IT version : products-dnastar-lasergene-genomics.aspx and all use manuals can also be downloaded or viewed from the web site.http://www.dnastar.com/t- products-dnastar-lasergene-genomics.aspx

5 SNP Genotyping Single SNP genotyping assay: Taqman – Life Technologies g.pdf g.pdf KASP genotyping - LGC Genomics chemistry/how-does-kasp-work/ chemistry/how-does-kasp-work/ Multiple SNP genotyping: SNP chip – Illumina Multiplex – Sequenom SNP genotyping by next generation sequencing Genotyping by sequencing (GBS) (http://cbsu.tc.cornell.edu/lab/doc/GBS_Method_Overview1.pdf)http://cbsu.tc.cornell.edu/lab/doc/GBS_Method_Overview1.pdf Restriction site associated DNA sequencing (RADseq) (http://bfg.oxfordjournals.org/content/9/5-6/416.full.pdf+html)http://bfg.oxfordjournals.org/content/9/5-6/416.full.pdf+html

6 AAGCTTGGTGCAATGACATTATACAATCAACAAAGAATAGAAAGGAGATAAAAAG CACTATCCAAATCCC TCCATTTTCCTTTTTTTGATTATTCCAGCTACCAAGACAACCACTAGGGGCAGTCC TTTGCATTTTTCTG CTACTGCTTGACTCACATCTTGTAGTTCAAGCGGGCAATCTTCCTTTTGAAACACT TTTTTCTGCAACAA TTGGCAACTCTCTTCTGTTGTGAGGAATGGAAGAGAATAAGGATCAGTATGGTAC TTGACTTGCTTACCC ACTTCTTCAAGTCGAGTTGTTACGACTATTCTGCTTCTAATTCCAACATCTGGAAA AGAAAGCCTTAAGT CATCCCATACCATACAATCCCACATATCATCCAATACAATGAGATATCTCTTTCCC ATTAATTTTCTCCT CAACATGTCGGCAAGAACATCAACCGTAGCTCCATTGTCGTTGAAACCTGTAACT TGACTGAAAATATCT TGTAATAACTCTATCCGGTTATACGTTTGAGAAATGATGCACCATGCTCGAACATC AAAGCGAGAAACAA TAATGTCATTATTGTACAACTTTCTAGCAATTGTCGTTTTCCCTTGTCCTCCCATGC CTACAATTGGGAC AACGTCTAGCTCATTTGTACCTCTAGTCAGATAATCAATTAGTTCTTCTGCTTGTTT CTCAAAACCCACT ACCTCCTCATCAGTTACAAGATTGCTATGTCGATCCGGCAGATGTTTTAATGGAG CAGCCACATAGTGAG TTGGCTTAAAATAAGTTTTTTTTAACTTAAAATATGTTATTTTGAGTATTGACAAACA ACTAAATAAGTC AAAAATCAGCTTTTAAGTCAGTTTGACCACGCTCTCTTAT Sw-5: AY Sw5-f1AACCACTAGGGGCAGTCCTT Sw5-r1CTCACTATGTGGCTGCTCCA (TGGAGCAGCCACATAGTGAG) Multiple Sequence Alignment SNP Discovery SNP ValidationSNP Genotyping Primer Design PCR PCR Product Sequencing Tool: Primer-BLAST AccessionGenesw5-snp StevensSw-5b31392A LA3667Sw-5b331A LA3433sw-5b331G LA2823sw-5b331G SNP Discovery by PCR

7 1.Download and Install BioEdit 2.Example data: Sw-5 of gene of tomato spotted wilt virus resistance 1.Run BioEdit and Find SNPs 2.Example – SNP discovery in TomatoSNP discovery in Tomato resistance-2009aps.ppt SNP Discovery Using BioEdit

8 Fall 2014 HORT6033 Molecular Plant Breeding Lecture 4 (09/03/2014) Homework 1.Download Tm-2 gene sequences from NCBI web site (GenBank), run BioEdit to find SNP markers for Tm-2 locus of tomato mosaic virus resistanc 2.Download Sw-5 gene sequences from GenBank and find SNP markers for Sw-5 alleles of spotted wilt virus resistance

9 AF536201_Tm2a TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACAC GTCTAGAGACCATAGACAT TGATCGACGTAGCCTCATTCAACCTCCTTCTGGTGTTTGGGAGTCTAAACA TTTGAGACATCTTTGTTAT AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACC CAAATATTTACTCATTGC ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACC GAGGTTGTTGCACCGATT GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCTACCGTTAA GATGTTATCAATATTTAGC CCTGTGCTTAAGGCGCTGGAGGTTCTGAAGCTCAGTTTTTCCAGTGACCCG AGTGAACAAATAAAGTTGT CATCGTATCCACATATTGCTAAGTTGCATTTGAATGTTAACAGAACAATGGC CTTGAACTCTCAATCATT TCCTCCAAATCTCATCAAGCTTACTCTAGCCTACTTTAGTGTAGACCGTTAT ATACTGGCAGTACTTAAG ACATTTCCCAAATTAAGAAAACTTAAAATGTTCATCTGCAAGTATAATGAAGA AAAGATGGATCTCTCGG GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAG CCCGAATGGGTTGTCTGA ___ AF536200_Tm TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACACGT CTAGAGACCATAGACAT TGATCGACGTAGCCTCATTCAACCTCCTTCTGGTGTTTGGGAGTCTAAACATT TGAGACATCTTTGTTAT AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACCCA AATATTTACTCATTGC ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACCGA GGTTGTTGCACCGATT GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCTACCGTTAAGA TGTTATCAATATTTAGC CCTGTGCTCAAGGCGCTGGAGGTTCTGAAGCTCAGTTTTTCCAGTGACCCGA GTGAACAAATAAAGTTGT CATCGTATCCACATATTGCTAAGTTGCATTTGAATGTTAACAGAACAATGGCCT TGAACTCTCAATCATT TCCTCCAAATCTCATCAAGCTTACTCTAGCCAACTTTACGGTAGACCGTTATAT ACTGGCAGTACTTAAG ACATTTCCCAAATTAAGAAAACTTAAAATGTTCATCTGCAAGTATAATGAAGAA AAGATGGATCTCTCGG GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGC CCGAATGGGTTGTCTGA ____ AF536199_tm TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACACGT CTAGAGACCATAGACAT TGATCGACGTAGCCTCATTCAACTTCCTTCTGGTGTTTGGGAGTCTAAACATT TGAGACATCTTTGTTAT AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACCCA AACATTTACTCATTGC ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACCGA GGTTGTTGCACCGATT GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCAACCGTTAAGA TATTATCAACATGTCGC CCTGTGCCAAAGGCGCTAAAGGTTCTGAAGCTCAGGTTTTTCAGTGATCCGA GTGAGCAAATAAACTTGT CATCCTATCCAAAAATTGTTAAGTTGCATTTGAATGTTGACAGAACAATAGCCT TGAACTCTGAAGCATT CCCTCCAAATATTATCAAGCTTACTCTTGTCTGCTTTATGGTAGACAGTTGTCT ACTGGCAGTGCTTAAG ACATTACCCAAATTAAGAAAACTTAAAATGGTCATCTGCAAGTATAATGAAGAA AAGATGGCTCTCTCGG GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGC CCGAATGGGTTGTCTGA ____ Primer Design Tool: Primer-BLAST PCR PCR Product Sequencing Tm2RS-f3 TGGAGGGGAATATTTGTGGA Tm2RS-r3 ACTTCAGACAACCCATTCGG (CCGAATGGGTTGTCTGAAGT) Multiple Sequence Alignment SNP Discovery SNP Genotyping CAPS Marker Identification SNP Markers for Tm-2 locus in Tomato

10 Reading Varshney et al Next-generation sequencing technologies and their implications for crop genetics and breeding. Trends in Biotechnology 27:522–530 (Linked)(Linked Liu et al An improved allele-specific PCR primer design method for SNP marker analysis and its application. Plant Methods 8: 34 (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC /pdf/ pdf)http://www.ncbi.nlm.nih.gov/pmc/articles/PMC /pdf/ pdf Gaur et al High-Throughput SNP Discovery and Genotyping for Constructing a Saturated Linkage Map of Chickpea (Cicer arietinum L.). DNA Res 19 (5): (http://dnaresearch.oxfordjournals.org/content/19/5/357.full)http://dnaresearch.oxfordjournals.org/content/19/5/357.full Shi et al Identification of molecular markers for Sw-5 gene of tomato spotted wilt virus resistance. American Journal of Biotechnology and Molecular Sciences (1): [PDF]


Download ppt "Fall 2014 HORT6033 Molecular Plant Breeding INSTRUCTOR: AINONG SHI HORT6033 web site:"

Similar presentations


Ads by Google