Presentation is loading. Please wait.

Presentation is loading. Please wait.

Fall 2014 HORT6033 Molecular Plant Breeding

Similar presentations


Presentation on theme: "Fall 2014 HORT6033 Molecular Plant Breeding"— Presentation transcript:

1 Fall 2014 HORT6033 Molecular Plant Breeding
Instructor: Ainong Shi HORT6033 web site:

2 Molecular Plant Breeding
Fall 2014 HORT6033 Molecular Plant Breeding Lecture 4 (09/03/2014) SNP SNP discovery by PCR Example Homework Question

3 Single Nucleotide Polymorphism (SNP)
A single nucleotide (A, T, C or G) mutation Use: genetic and genome mapping, Association studies, Genetic diversity analysis, and Tagging important genes Approach: SNP discovery from PCR SNP discovery from High throughput - Next generation sequencing (NGS) – RNA-Seq, RAD-Seq, GBS etc. (http://learn.genetics.utah.edu/content/pharma/snips/)

4 SNP Discovery Tool There are dozens of tools for SNP discovery. We will talk below two: BioEdit Download: Manual: DNASTAR Lasergene Genomics Suite Download free TRY IT version : products-dnastar-lasergene-genomics.aspx and all use manuals can also be downloaded or viewed from the web site.

5 SNP Genotyping Single SNP genotyping assay:
Taqman – Life Technologies KASP genotyping - LGC Genomics Multiple SNP genotyping: SNP chip – Illumina Multiplex – Sequenom SNP genotyping by next generation sequencing Genotyping by sequencing (GBS) (http://cbsu.tc.cornell.edu/lab/doc/GBS_Method_Overview1.pdf) Restriction site associated DNA sequencing (RADseq) (http://bfg.oxfordjournals.org/content/9/5-6/416.full.pdf+html)

6 SNP Discovery by PCR Primer Design PCR PCR Product Sequencing
AAGCTTGGTGCAATGACATTATACAATCAACAAAGAATAGAAAGGAGATAAAAAGCACTATCCAAATCCC TCCATTTTCCTTTTTTTGATTATTCCAGCTACCAAGACAACCACTAGGGGCAGTCCTTTGCATTTTTCTG CTACTGCTTGACTCACATCTTGTAGTTCAAGCGGGCAATCTTCCTTTTGAAACACTTTTTTCTGCAACAA TTGGCAACTCTCTTCTGTTGTGAGGAATGGAAGAGAATAAGGATCAGTATGGTACTTGACTTGCTTACCC ACTTCTTCAAGTCGAGTTGTTACGACTATTCTGCTTCTAATTCCAACATCTGGAAAAGAAAGCCTTAAGT CATCCCATACCATACAATCCCACATATCATCCAATACAATGAGATATCTCTTTCCCATTAATTTTCTCCT CAACATGTCGGCAAGAACATCAACCGTAGCTCCATTGTCGTTGAAACCTGTAACTTGACTGAAAATATCT TGTAATAACTCTATCCGGTTATACGTTTGAGAAATGATGCACCATGCTCGAACATCAAAGCGAGAAACAA TAATGTCATTATTGTACAACTTTCTAGCAATTGTCGTTTTCCCTTGTCCTCCCATGCCTACAATTGGGAC AACGTCTAGCTCATTTGTACCTCTAGTCAGATAATCAATTAGTTCTTCTGCTTGTTTCTCAAAACCCACT ACCTCCTCATCAGTTACAAGATTGCTATGTCGATCCGGCAGATGTTTTAATGGAGCAGCCACATAGTGAG TTGGCTTAAAATAAGTTTTTTTTAACTTAAAATATGTTATTTTGAGTATTGACAAACAACTAAATAAGTC AAAAATCAGCTTTTAAGTCAGTTTGACCACGCTCTCTTAT Sw-5: AY007366 Tool: Primer-BLAST Primer Design Sw5-f1 AACCACTAGGGGCAGTCCTT Sw5-r1 CTCACTATGTGGCTGCTCCA (TGGAGCAGCCACATAGTGAG) PCR PCR Product Sequencing Multiple Sequence Alignment Accession Gene sw5-snp Stevens Sw-5b 31392 A LA3667 331 LA3433 sw-5b G LA2823 SNP Discovery SNP Validation SNP Genotyping

7 SNP Discovery Using BioEdit
Download and Install BioEdit Example data: Sw-5 of gene of tomato spotted wilt virus resistance Run BioEdit and Find SNPs Example – SNP discovery in Tomato resistance-2009aps.ppt

8 Molecular Plant Breeding
Fall 2014 HORT6033 Molecular Plant Breeding Lecture 4 (09/03/2014) Homework Download Tm-2 gene sequences from NCBI web site (GenBank), run BioEdit to find SNP markers for Tm-2 locus of tomato mosaic virus resistanc Download Sw-5 gene sequences from GenBank and find SNP markers for Sw-5 alleles of spotted wilt virus resistance

9 Multiple Sequence Alignment
SNP Markers for Tm-2 locus in Tomato AF536199_tm-2 TGATCGACGTAGCCTCATTCAACTTCCTTCTGGTGTTTGGGAGTCTAAACATTTGAGACATCTTTGTTAT TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACACGTCTAGAGACCATAGACAT AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACCCAAACATTTACTCATTGC CCTGTGCCAAAGGCGCTAAAGGTTCTGAAGCTCAGGTTTTTCAGTGATCCGAGTGAGCAAATAAACTTGT GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCAACCGTTAAGATATTATCAACATGTCGC ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACCGAGGTTGTTGCACCGATT ACATTACCCAAATTAAGAAAACTTAAAATGGTCATCTGCAAGTATAATGAAGAAAAGATGGCTCTCTCGG CCCTCCAAATATTATCAAGCTTACTCTTGTCTGCTTTATGGTAGACAGTTGTCTACTGGCAGTGCTTAAG CATCCTATCCAAAAATTGTTAAGTTGCATTTGAATGTTGACAGAACAATAGCCTTGAACTCTGAAGCATT ____------ GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGCCCGAATGGGTTGTCTGA AF536201_Tm2a TGATCGACGTAGCCTCATTCAACCTCCTTCTGGTGTTTGGGAGTCTAAACATTTGAGACATCTTTGTTAT TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACACGTCTAGAGACCATAGACAT AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACCCAAATATTTACTCATTGC CCTGTGCTTAAGGCGCTGGAGGTTCTGAAGCTCAGTTTTTCCAGTGACCCGAGTGAACAAATAAAGTTGT GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCTACCGTTAAGATGTTATCAATATTTAGC ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACCGAGGTTGTTGCACCGATT ACATTTCCCAAATTAAGAAAACTTAAAATGTTCATCTGCAAGTATAATGAAGAAAAGATGGATCTCTCGG TCCTCCAAATCTCATCAAGCTTACTCTAGCCTACTTTAGTGTAGACCGTTATATACTGGCAGTACTTAAG CATCGTATCCACATATTGCTAAGTTGCATTTGAATGTTAACAGAACAATGGCCTTGAACTCTCAATCATT ___ GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGCCCGAATGGGTTGTCTGA AF536200_Tm2 TGATCGACGTAGCCTCATTCAACCTCCTTCTGGTGTTTGGGAGTCTAAACATTTGAGACATCTTTGTTAT TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACACGTCTAGAGACCATAGACAT AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACCCAAATATTTACTCATTGC CCTGTGCTCAAGGCGCTGGAGGTTCTGAAGCTCAGTTTTTCCAGTGACCCGAGTGAACAAATAAAGTTGT GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCTACCGTTAAGATGTTATCAATATTTAGC ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACCGAGGTTGTTGCACCGATT ACATTTCCCAAATTAAGAAAACTTAAAATGTTCATCTGCAAGTATAATGAAGAAAAGATGGATCTCTCGG TCCTCCAAATCTCATCAAGCTTACTCTAGCCAACTTTACGGTAGACCGTTATATACTGGCAGTACTTAAG CATCGTATCCACATATTGCTAAGTTGCATTTGAATGTTAACAGAACAATGGCCTTGAACTCTCAATCATT ____ GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGCCCGAATGGGTTGTCTGA Tool: Primer-BLAST Primer Design Tm2RS-f3 TGGAGGGGAATATTTGTGGA Tm2RS-r3 ACTTCAGACAACCCATTCGG (CCGAATGGGTTGTCTGAAGT) PCR PCR Product Sequencing Multiple Sequence Alignment SNP Discovery CAPS Marker Identification SNP Genotyping SNP Genotyping

10 Reading Varshney et al Next-generation sequencing technologies and their implications for crop genetics and breeding. Trends in Biotechnology 27:522–530 (Linked) Liu et al An improved allele-specific PCR primer design method for SNP marker analysis and its application. Plant Methods 8: 34 (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC /pdf/ pdf) Gaur et al High-Throughput SNP Discovery and Genotyping for Constructing a Saturated Linkage Map of Chickpea (Cicer arietinum L.). DNA Res 19 (5): (http://dnaresearch.oxfordjournals.org/content/19/5/357.full) Shi et al Identification of molecular markers for Sw-5 gene of tomato spotted wilt virus resistance. American Journal of Biotechnology and Molecular Sciences (1): [PDF]


Download ppt "Fall 2014 HORT6033 Molecular Plant Breeding"

Similar presentations


Ads by Google