Presentation is loading. Please wait.

Presentation is loading. Please wait.

بسم الله الرحمن الرحيم (وإن لكم في الأنعام لعبرة نسقيكم مما في بطونه ، من بين فرث ودم لبناً خالصاً سائغاً للشاربين ) سورة النحل آيه (66)

Similar presentations


Presentation on theme: "بسم الله الرحمن الرحيم (وإن لكم في الأنعام لعبرة نسقيكم مما في بطونه ، من بين فرث ودم لبناً خالصاً سائغاً للشاربين ) سورة النحل آيه (66)"— Presentation transcript:

1

2

3

4 بسم الله الرحمن الرحيم (وإن لكم في الأنعام لعبرة نسقيكم مما في بطونه ، من بين فرث ودم لبناً خالصاً سائغاً للشاربين ) سورة النحل آيه (66)

5 Brucella spp. Brucella spp.( Coccobacilli )

6  Drinking Un- pasteurized camel, sheep, goat or cattle Milk  Contact with Infected Animals

7

8

9

10

11 Surgeon David Bruce;1887 Micrococcus melitensis

12 Gram Negative coccobacilli Culture on Chocolate agar Microbiological Characteristics of Brucella spp

13

14

15 Portals of Entry

16 Fever, headache Sore throat Joint Pain Muscle Aches Ear Aches Fatigue Anorexia

17 1 Clinical 2 Blood Cultures 3 Serology 4 PCR

18

19 To compare 3 of the reported PCR techniques for Diagnosis of Brucellosis from Human blood and determine the most suitable technique for a Clinical Microbiology Lab in terms of Sensitivity, Specificity, Robustness and Ease of Implementation

20

21 Material 147 random samples from Brucellosis patients 50 control samplesQuestionnaire Brucella melitensis

22 Methods 3 PCR techniques using genus specific primers ElectrophoresisLimit of Detection DNA extraction

23 Primers (B 4 and B 5 ) Brucella abortus 223bp fragment B 4 =5 TGGCTCGGTTGCCAATATCAA3' B 5 =5' CGCGCTTGCCTTTCAGGTCTG-3' StepTempTime 1Initial Denaturation93 o C5 min 2Template Denaturation90 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C7 min Cycling Profile Repeated 35 times

24 Primers (JPF and JPR) Brucella abortus encoding 193bp ) JPF=5' GCGCTCAGGCTGCCGACGCAA-3' JPR=5' ACCAGCCATTGCGGTCGGTA-3' StepTempTime 1Initial Denaturation94 o C4 min 2Template Denaturation94 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C3 min Repeated 35 cycles Cycling Profile

25 Primers (F 4 and R 2 ) Brucella abortus 905bp fragment. (Romero et al.,1995 ). F4 = 5'TCGAGCGCCCGCAAAGGG-3' R 2 = 5'AACCATAGTGTCTCCACTAA-3' Cycling Profile StepTempTime 1Initial Denaturation95 o C5 min 2Template Denaturation95 o C30 Sec 3Primer Annealing54 o C90 Sec 4Primer Extension72 o C90 Sec 5Final Extension72 o C6 min Repeated 30 cycles

26 (PCR Work Station - Plas Labs)

27 (MyCycler - Bio Rad)

28 STEPS INVOLVED Taq Polymerase Forward Primer Reverse Primer

29

30

31 P =0.05 Age Distribution of Brucella species Less than 25 ys25 to < 50 ysMore than 50 ys

32 Fever Anorexia Headache Vomiting Fatigue P=0.001 Symptoms of Brucellosis in the study population Body aches

33 Smudged bands DNA Extraction

34 M

35 Modifications

36 StepTempTime 1Initial Denaturation93 o C5 min 2Template Denaturation90 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C7 min Repeated 40 times تكرر 40

37 Repeated 40 times StepTempTime 1Initial Denaturation94 o C4 min 2Template Denaturation94 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C3 min تكرر 40

38 Repeated 35 times StepTempTime 1Initial Denaturation95 o C5 min 2Template Denaturation95 o C30 Sec 3Primer Annealing54 o C90 Sec 4Primer Extension72 o C90 Sec 5Final Extension72 o C6 min تكرر (35) تكرر 35

39

40

41

42

43 7x 10 2 cfu/ml

44 7 x 10 5 cfu/ml

45 7 x 10 7 cfu/ml

46 144 (98.0)* 130 (88.4)* 78 (53.1) * 69(147) 17 (147) 3 (147) (100) 50 P= Results obtained using the 3 sets of primers

47 P = 0.05 Senitivity and Specificity of the 3 sets of primers

48

49 Egyptian Journal of Medical Microbiology, 2007

50 Canadian Journal of Microbiology, 2008

51 Thank you


Download ppt "بسم الله الرحمن الرحيم (وإن لكم في الأنعام لعبرة نسقيكم مما في بطونه ، من بين فرث ودم لبناً خالصاً سائغاً للشاربين ) سورة النحل آيه (66)"

Similar presentations


Ads by Google