4. بسم الله الرحمن الرحيم (وإن لكم في الأنعام لعبرة نسقيكم مما في بطونه ، من بين فرث ودم لبناً خالصاً سائغاً للشاربين ) سورة النحل آيه (66)

5. Brucella spp. Brucella spp.( Coccobacilli )

6.  Drinking Un- pasteurized camel, sheep, goat or cattle Milk  Contact with Infected Animals

11. Surgeon David Bruce;1887 Micrococcus melitensis

12. Gram Negative coccobacilli Culture on Chocolate agar Microbiological Characteristics of Brucella spp

14. 1 2 3 4

15. Portals of Entry

16. Fever, headache Sore throat Joint Pain Muscle Aches Ear Aches Fatigue Anorexia

17. 1 Clinical 2 Blood Cultures 3 Serology 4 PCR

19. To compare 3 of the reported PCR techniques for Diagnosis of Brucellosis from Human blood and determine the most suitable technique for a Clinical Microbiology Lab in terms of Sensitivity, Specificity, Robustness and Ease of Implementation

21. Material 147 random samples from Brucellosis patients 50 control samplesQuestionnaire Brucella melitensis

22. Methods 3 PCR techniques using genus specific primers ElectrophoresisLimit of Detection DNA extraction

23. Primers (B 4 and B 5 ) Brucella abortus 223bp fragment B 4 =5 TGGCTCGGTTGCCAATATCAA3' B 5 =5' CGCGCTTGCCTTTCAGGTCTG-3' StepTempTime 1Initial Denaturation93 o C5 min 2Template Denaturation90 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C7 min Cycling Profile Repeated 35 times

24. Primers (JPF and JPR) Brucella abortus encoding 193bp ) JPF=5' GCGCTCAGGCTGCCGACGCAA-3' JPR=5' ACCAGCCATTGCGGTCGGTA-3' StepTempTime 1Initial Denaturation94 o C4 min 2Template Denaturation94 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C3 min Repeated 35 cycles Cycling Profile

25. Primers (F 4 and R 2 ) Brucella abortus 905bp fragment. (Romero et al.,1995 ). F4 = 5'TCGAGCGCCCGCAAAGGG-3'-63-79 R 2 = 5'AACCATAGTGTCTCCACTAA-3'947-966 Cycling Profile StepTempTime 1Initial Denaturation95 o C5 min 2Template Denaturation95 o C30 Sec 3Primer Annealing54 o C90 Sec 4Primer Extension72 o C90 Sec 5Final Extension72 o C6 min Repeated 30 cycles

26. (PCR Work Station - Plas Labs)

27. (MyCycler - Bio Rad)

28. STEPS INVOLVED Taq Polymerase Forward Primer Reverse Primer

31. P =0.05 Age Distribution of Brucella species Less than 25 ys25 to < 50 ysMore than 50 ys

32. Fever Anorexia Headache Vomiting Fatigue P=0.001 Symptoms of Brucellosis in the study population Body aches

33. Smudged bands DNA Extraction

34. M 1 2 3 4 5 6 7 8 9 10 11 12 13 14

35. Modifications

36. StepTempTime 1Initial Denaturation93 o C5 min 2Template Denaturation90 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C7 min Repeated 40 times تكرر 40

37. Repeated 40 times StepTempTime 1Initial Denaturation94 o C4 min 2Template Denaturation94 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C3 min تكرر 40

38. Repeated 35 times StepTempTime 1Initial Denaturation95 o C5 min 2Template Denaturation95 o C30 Sec 3Primer Annealing54 o C90 Sec 4Primer Extension72 o C90 Sec 5Final Extension72 o C6 min تكرر (35) تكرر 35

43. 7x 10 2 cfu/ml

44. 7 x 10 5 cfu/ml

45. 7 x 10 7 cfu/ml

46. 144 (98.0)* 130 (88.4)* 78 (53.1) * 69(147) 17 (147) 3 (147) (100) 50 P=0.0001 Results obtained using the 3 sets of primers

47. P = 0.05 Senitivity and Specificity of the 3 sets of primers

49. Egyptian Journal of Medical Microbiology, 2007

50. Canadian Journal of Microbiology, 2008

51. Thank you