Presentation is loading. Please wait.

Presentation is loading. Please wait.

Diagnostic testing Used to confirm or rule out a known suspected (mutation) genetic disorder in a symptomatic person. Predictive testing Tells an asymptomatic.

Similar presentations


Presentation on theme: "Diagnostic testing Used to confirm or rule out a known suspected (mutation) genetic disorder in a symptomatic person. Predictive testing Tells an asymptomatic."— Presentation transcript:

1 Diagnostic testing Used to confirm or rule out a known suspected (mutation) genetic disorder in a symptomatic person. Predictive testing Tells an asymptomatic individual if he/she carries a mutation that will cause, or put them at higher risk for, a disease later in life. Newborn screening Detects common disorders in newborns, where immediate treatment can prevent dangerous symptoms Carrier testing Tells a person whether or not he carries a mutation that could be passed on to his offspring. One can be a carrier, but not be at risk for a disease (recessive genes) ??? ? Genetic Testing – Why test DNA?

2 Human Karyotype Genome: all genetic material in a nucleus. Humans: 22 pairs of autosomes 1 pair of sex chromosomes X & Y

3 DNA in the Cell chromosome cell nucleus Double stranded DNA molecule Individual nucleotides Every body cell has 46 chromosomes. Every sex cell (egg/sperm) has 23 chromosomes.

4 Each nucleotide contains: Nitrogenous Base Sugar (deoxyribose) Phosphate Group

5 4 different bases make up the steps of the ladder A Adenine T Thymine G Guanine C Cytosine

6 Base Pairing Rules Sugar- Phosphate backbone G-C A-T

7 Each rung on the ladder is called a 1 base pair (bp) 2 base pair (bp) 3 base pair (bp) How many base-pairs are there in the human genome? ( in 1 nucleus / 46 chromosomes) approximately 3 billion base-pair

8 A C G G T A A G C A T A G C C G T G A G T T T A C C A G The Genetic Code A series of Gs As Cs & Ts How much of your DNA is identical to everyone else? 99.4%

9 DNA RNA Protein Function

10 Some genes are expressed in every cell …But the proteins they code for may have different effects/interactions on each cell type. Some genes are expressed only in a particular type of cell, giving that cell type its unique structure and function

11 DNA Protein Function Levels of Genetic Testing normalmutated Analysis of whole chromosomes – for large changes; extra chromosome, very large deletions or insertions atcgatcgatcgatcgaAcgatcg Analysis of sequence – for small changes; mutations in the sequence, small deletions or insertions Analysis of protein shape – for any change that may affect the folding of the protein Analysis of protein function – if the functional protein is supposed to make something, then some tests can detect the presence or absence of the product XX

12 Organization of the Human Genome Gene – region that encodes for a protein or a trait Eye color Dimples Freckles Blood type MOMDAD

13 Organization of the Human Genome Every gene can have alternate forms called alleles Blue eyes Dimples No Freckles Type I A For every gene in your DNA you have… 2 alleles. Homozygous (same) Heterozygous (different) MOMDAD Brown eyes No dimples Freckles Type I B

14 aaaccatctaggctatattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg gggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagctagtg atgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatcgatctatcggatct atctactagagctactacgatcagggactactacgagcatcgactacgaggcttctagaggctatattctaggcta ctacgatcgatctacgtagctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcaa aggtttttttttttcagctagctggggggggggggatcgggtgtgtcgatgtgtgagcaaaatattagcaacccccc ccccattactgatgtcattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg gggggggacacagcgatctaatataaatctgatgatcaaaggtttttttttttcagctagcttacgatcgatctacgta gctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaa aaaaacgtgagctagtgatgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcgg atatcgatctagatatcgatctatcggatctatctactagagctactacgatcagggatatcgatctatcggatctatc tactagagctactacgatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctaggcta tattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacgagcatcgactacgag gcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtggggggggacacag cgatctaatataaacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagct agtgatgggtgatgtcagtgtagtcgtagtcgtacgatcagggatatcgatctatcggatctatctactagagctac tacgatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctaggctatattcggatgatc tatctactagagctgatctatctactagagctgtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatc Normal Examples of Mutations in the DNA Sequence…

15 aaaccatctaggctatattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg gggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagctagtg atgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatcgatctatcggatct atctactagagctactacgatcagggactactacgagcatcgactacgaggcttctagaggctatattctaggcta ctacgatcgatctacgtagctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcaa aggtttttttttttcagctagctggggggggggggatcgggtgtgtcgatgtgtgagcaaaatattagcaacccccc ccccattactgatgtcattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg gggggggacacagcgatctaatataaatctgataatcaaaggtttttttttttcagctagcttacgatcgatctacgta gctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaa aaaaacgtgagctagtgatgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcgg atatcgatctagatatcgatctatcggatctatctactagagctactacgatcagggatatcgatctatcggatctatc tactagagctactacgatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctaggcta tattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacgagcatcgactacgag gcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtggggggggacacag cgatctaatataaacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagct agtgatgggtgatgtcagtgtagtcgtagtcgtacgatcagggatatcgatctatcggatctatctactagagctac tacgatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctaggctatattcggatgatc tatctactagagctgatctatctactagagctgtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatc Single base pair mutation Examples of Mutations in the DNA Sequence… (Sickle cell anemia)

16 aaaccatctaggctatattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg gggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagctagtg atgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatcgatctatcggatct atctactagagctactacgatcagggactactacgagcatcgactacgaggcttctagaggctatattctaggcta ctacgatcgatctacgtagctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcaa aggtttttttttttcagctagctggggggggggggatcgggtgtgtcgatgtgtgagcaaaatattagcaacccccc ccccattactgatgtcattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg gggggggacacagcgatctaatataaatctgatggtcaaaggtttttttttttcagctagcttacgatcgatctacgta gctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaa aaaaacgtgagctagtgatgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcgg atatcgatctagatggggatctatcggatctatctactagagctactacgatcagggatatcgatctatcggatctat ctactagagctactacgatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctaggct atattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacgagcatcgactacga ggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtggggggggacaca gcgatctaatataaacacagcgatctaatataaatctgatgatcgatcgacatttttttttaaaaaaaaaaaaaaacg tgagctagtgatgggtgatgtcagtgtagtcgtagtcgtacgatcagggatatcgatctatcggatctatctactag agctactacgatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctaggctatattcg gatgatctatctactagagctgatctatctactagagctgtcgtagtcgtgtgataaaaaaccatctaggctatattc ggatatc Multiple mutations Examples of Mutations in the DNA Sequence… (Diabetes, susceptibility to breast cancer)

17 aaaccatctaggctatattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg gggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagctagtg atgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatcgatctatcggatct atctactagagctactacgatcagggactactacgagcatcgactacgaggcttctagaggctatattctaggcta ctacgatcgatctacgtagctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcaa aggtttttttttttcagctagctggggggggggggatcgggtgtgtcgatgtgtgagcaaaatattagcaacccccc ccccattactgatgtcattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg gggggggacacagcgatctaatataaatctgatgatcaaaggtttttttttttcagctagcttacgatcgatctacgta gctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaa aaaaacgtgagctagtgatgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcgg atatcgatctagatatcgatctatcggatctatctactagagctactacgatcagggatatcgatctatcggatctatc tactagagctactacgatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctaggcta tattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacgagcatcgactacgag gcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtggggggggacacag cgatctaatataaacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagct agtgatgggtgatgtcagtgtagtcgtagtcgtacgatcagggatatcgatctatcggatctatctactagagctac tacgatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctaggctatattcggatgatc tatctactagagctgatctatctactagagctgtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatc Deletion Examples of Mutations in the DNA Sequence… (Cystic fibrosis)

18 aaaccatctaggctatattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg gggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagctagtg atgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatcgatctatcggatct atctactagagctactacgatcagggactactacgagcatcgactacgaggcttctagaggctatattctaggcta ctacgatcgatctacgtagctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcaa aggtttttttttttcagctagctggggggggggggatcgggtgtgtcgatgtgtgagcaaaatattagcaacccccc ccccattactgatgtcattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg gggggggacacagcgatctaatataaatctgatgatcaaaaaaaaaaaaaaaaaaggtttttttttttcagctagct tacgatcgatctacgtagctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcgat cgacataaaaaaaaaaaaaaacgtgagctagtgatgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaacc atctaggctatattcggatatcgatctagatatcgatctatcggatctatctactagagctactacgatcagggatatc gatctatcggatctatctactagagctactacgatcagggatatcgatctatcggatctatctactagagctactacg atcaggatctaggctatattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacg agcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgt ggggggggacacagcgatctaatataaacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaa aaaaaaacgtgagctagtgatgggtgatgtcagtgtagtcgtagtcgtacgatcagggatatcgatctatcggatc tatctactagagctactacgatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctag gctatattcggatgatctatctactagagctgatctatctactagagctgtcgtagtcgtgtgataaaaaaccatcta ggctatattcggatatc Insertion Examples of Mutations in the DNA Sequence… (Huntingtons disease)

19 STRs Short Tandem Repeats (smaller segments with fewer repeats) CGAA CGAA CGAA CGAA CGAA CGAA CGAA CGAA CGAA CGAA CGAA VNTRs Variable Number Tandom Repeats (larger segments with many repeats) GGACTAATATCTATTCCCTAATATGACTAA AATATTTCGGACTAGATATCTTTCGGACTTA TCTATTCGGGAGCCGCTACCCGTG… …X 1000

20 A gene that includes a tandem repeat sequence can have many different alleles in a population. Ex: Allele 1: (6 repeats) GAACT ATTA ATTA ATTA ATTA ATTA ATTA CGTGCAGGCT Allele 2: (5 repeats) GAACT ATTA ATTA ATTA ATTA ATTA CGTGCAGGCT Allele 3: (7 repeats) GAACT ATTA ATTA ATTA ATTA ATTA ATTA ATTA GTGCAGGCT

21 How do we look for a mutation in a DNA sequence? Sequencing Agarose Gel Electrophoresis PCR RFLP analysis Probes –Dot blot –Microarray

22 PCR Procedure 1.Heat DNA strands, causing strands to unzip. 2.Cool, add primer pairs, short sequences of DNA (starter pieces) that will bind to the complementary sequences at the beginning of the separated DNA strands. Annealing 3.Add: A.DNA polymerase - replicator machine B.Nucleotides (AGCT) building blocks for new DNA C.Heat to around 75° C for the completion.

23 Make copies (extend primers) Starting DNA Template Add primers (anneal) Forward primer Reverse primer DNA Amplification with the Polymerase Chain Reaction (PCR) Separate strands (denature)

24 In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created PCR Copies DNA Exponentially through Multiple Thermal Cycles Original DNA target region Thermal cycle Each cycle takes less than 2 minutes from start to finish.

25 PCR Electrophoresis Electrophoresis

26 At least one lane must contain a DNA ladder (a set of molecules with known sizes. Each band in these lanes contains a known length of DNA. These ladders are used to determine the length of the DNA in fragments in other lanes. From the size of the fragment, the number of repeat sequences can be determined.

27

28 Each person has 2 alleles for a gene. M/D The resulting pattern of an STR sequence for a single gene has either 1 or 2 bands Can be homozygous or heterozygous for each gene. 1 band = homozygous – both fragments same length 2 bands = heterozygous – different fragment lengths 17 repeats 16 repeats 15 repeats 14 repeats 13 repeats 12 repeats 11 repeats 10 repeats 9 repeats 8 repeats 7 repeats 6 repeats

29

30 Available Predictive Tests Cystic Fibrosis Tay Sachs Disease Lou Gherigs Disease (ALS) Huntingtons Disease Catastrophically high cholesterol Rare Cancers Inherited susceptibilty to cancer Breast Cancer Colon Cancer Thyroid Cancer


Download ppt "Diagnostic testing Used to confirm or rule out a known suspected (mutation) genetic disorder in a symptomatic person. Predictive testing Tells an asymptomatic."

Similar presentations


Ads by Google