Presentation is loading. Please wait.

Presentation is loading. Please wait.

Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

Similar presentations


Presentation on theme: "Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II."— Presentation transcript:

1 Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II. RNA interference A. Basics of RNAi B. RNAi methods in flies III. Targeted gene replacement

2 target geneenhancer lacZwhite enhancer trap: expresses Gal in same pattern as target gene P element constructs

3 UASwhite controlled misexpression: expresses target gene in Gal4- dependent manner P element constructs GAL4white GAL4 enhancer trap: expresses Gal4p in same pattern as target gene

4 yellowwhite insulators: block enhancers and position effects on expression P element constructs

5 P{PZ} enhancer trap523 P{lacW} enhancer trap1176 P{Gal4} Gal4 expression141 P{EP} UAS-controlled expression P{SUPor-P} insulator 263 2076 P{GT1} gene trap511 Mapped P element Insertion Lines (Bloomington Stock Center, as of 11/12/02) 4690

6 w P{w + } P element on X chromosome Sb 2-3 + P transposase (chromosome 3) dominant marker Transposition of P Elements w + ; Y P{w+}P{w+} new insertion on autosome w P{w + } Sb 2-3 + ; Y w screen for red-eyed sons

7 Spradling et al. (1995) P elements rarely insert into coding sequences

8 w ; P{w + } Sb 2-3 + P element on chromosome 3 P transposase (chromosome 3) dominant marker w Excision of P Elements Sb 2-3 P{w+}P{w+}w Y ; w + ; Y P{w + }** screen for loss of w+, indicating excision

9 white P transposase...ATGCCAAACATGATGAAATAACATAAGGTGGTCCCGTCG......TACGGTTTGTACTACTTTATTGTATTCCACCAGGGCAGC... 31-bp P inverted repeat8-bp target site P transposase...ATGCCAAACATGATGAAATAACATA...TACGGTTT 17-nt 3 overhang

10 different products, depending on: template for repair extent of repair gap widening before repair non-homologous end-joining homologous recombination (double-strand break)

11 whi internal deletion of P element (w-) sometimes alters expression of target gene A. Repair using sister chromatid as a template white restoration of P element (w+) B. Repair using homologous chromosome as a template precise excision useful for proving that phenotypes are due to P element insertion

12 C. Imprecise excision exonuclease repair deletion of flanking DNA

13 RNA Interference dsRNA Dicer endonuclease 21-23 bp (or nt) siRNA destroy mRNA find complementary mRNA (RISC complex)

14 Functions for RNA Interference Repression of repeated genes (e.g., transposable elements) Defense against viruses (plants) Developmental control of gene expression (small temporal RNAs) X chromosome inactivation (mammals) Silencing of mating type loci and centromeric regions (S. pombe) DNA elimination in macronuclei (Tetrahymena) Experimental manipulation of gene function.

15 RNAi Methods in Drosophila 1. Addition of dsRNA to cell culture 2. Injection of dsRNA into embryos 3. Expression of hairpin RNA in vivo. UAS Gal4 RNA dsRNA

16 Gene Targeting Technologies S. cerevisiae Generate linear targeting DNA by PCR Transform suitable strain Plate on medium for positive selection (10 -8 ?) M. musculus Generate targeting DNA by cloning, cutting Transform ES cells Conduct positive and negative selections (typical = 10 -7 )

17 Gene Targeting in Drosophila Problems No culture system for germline stem cells DNA introduced by injection in single embryos Existence of DNA repair in early development questionable Solution (Rong and Golic) Generate linear DNA in vivo: Obtain stable transformants of donor construct Use FLP – FRT system to excise donor DNA from chromosome Use I-SceI to linearize donor DNA Use visible marker gene to screen for potential homologous gene replacements

18 FRT FLP Recombinase Catalyzes Exchange Between Target Sequences (FRTs) FLP recombinase crossover

19 FRT Intrachromosomal Recombination Between Tandem FRTs Results in Excision from the Chromosome extrachromosomal circle with 1 FRT chromosome with 1 FRT

20 5' ATTACCCTGTTATCCCTAAATT 3' 3' TAATGGGACAATAGGGATTTAA 5' 5' ATTACCCTGTTAT CCCTAAATT 3' 3' TAATGGGAC AATAGGGATTTAA 5' I-SceI I-SceI makes a double-strand break at an 18-bp target sequence

21 FRT donor construct (integrated P element) I-SceI site FLP recombinase extrachromosomal circular donor

22 I-SceI endonuclease DSB * * integration tandem duplication

23 w+ * FLP recombinase I-SceI endonuclease * * w+ integration

24 * w+ I-CreI endonuclease * w+ DSB I-CreI site * Repair of a DSB between direct repeats Tandem Duplications can be Reduced to Single Copy

25 Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II. RNA interference A. Basics of RNAi B. RNAi methods in flies III. Targeted gene replacement


Download ppt "Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II."

Similar presentations


Ads by Google