Presentation is loading. Please wait.

Presentation is loading. Please wait.

Plant Hormones Anjali More University of Arkansas.

Similar presentations


Presentation on theme: "Plant Hormones Anjali More University of Arkansas."— Presentation transcript:

1 Plant Hormones Anjali More University of Arkansas

2 Why do plants need hormones? Hormones enable plants to: Respond to environmental factors and changes Direct developmental processes

3 Why do plants need hormones? Pathogens Parasites Humidity Temperature Light Toxins Insects Oxygen Stress

4 What are hormones? Harman - to set in motion A chemical messenger from one cell (or group of cells) to another Signal molecules produced at specific locations Found in low concentrations Cause altered processes in target cells at other locations Found in multicellular organisms

5 What are plant hormones? 1.Occur in small amounts 2.Organic compounds 3.Synthesized by plants 4.Active at low concentrations 5.Promote or inhibit growth and developmental responses 6.Often show a separation from the site of production and the site of action Plant hormones do not always have all these characteristics Plant growth regulators or plant growth substances

6 Plant hormones are chemical messengers Hormone synthesis Message Physiological response

7 General Plant Hormones Auxins Cytokinins Abscisic acid Ethylene Gibberellins Jasmonic acid Salicylic acid Classical phytohormones

8 Auxins Indole-3-acetic acid (IAA) Auxein - to grow First plant hormone discovered Occurs in very low concentrations Confers apical dominance Regulates developmental processes, e.g. cell division, cell elongation etc Auxin – important for root development

9 Cytokinins Effect of cytokinin application on leaf senescence Stimulates cell division Lateral bud development Delays senescence and promotes nutrient uptake Rost et al., 1998

10 Abscisic acid Abscisin II- role in abscission Released during desiccation (of vegetative tissue) Produced in response to stress Synthesized in green fruits and seeds General growth inhibitor – inhibits fruit ripening ABA – The stress hormone jan01/acid0101.htm?pf=1

11 Ethylene Fruit ripening Opening of flowers Induces seed germination Initiation of stem elongation and bud development Tomato Banana Ethylene treated

12 Gibberellins Ubiquitous in both flowering (angiosperms) and non- flowering (gymnosperms) plants as well as ferns Many forms exist, named GA…GAn in the order of discovery

13 Discovered in association with foolish seedling disease of rice (Bakanae) caused by the fungus, Gibberella fujikuroi. The fungus produces GA. uninfectedinfected Yabuta and Sumiki, 1938 Gibberellins

14 Synthesized in the apical portions of both stem and roots Important effect on stem elongation in plants Application of gibberellins promotes internode elongation Involved in many other aspects of plant growth Gibberellins science/ html

15 Cell elongation Seed germination Flower induction Breaking dormancy Functions of gibberellins - GA + GA Fewer flowers and larger fruits Delayed harvesting Increased fruit size GAs are commercially used for increased fruit size in table grapes and to regulate citrus flowering and rind maturation Fruit growth – seedless grapes

16 Gibberellin mutants Elongated mutants – constitutive GA response (e.g. spy in arabidopsis) or enhanced GA response (e.g. lv in pea) Dwarf mutants – three groups 1.Accumulate GA and mostly unresponsive to applied GA (e.g. gai in arabidopsis) 2.Reduced GA response but attain full responses with high doses of exogenous (added) GA (e.g. lgr in pea) 3.Reduced GA response but do not respond to the application of high doses of GA (e.g. lk and lkb in pea) Ross et al. 1997

17 Dwarf mutants A comparison of 28 day-old plant of the normal and Dwarf-1 mutant in bean Praona and Green, 1967 Normal rice (right) and the GA- deficient superdwarf mutant.

18 Significance of GA mutants Insight into GA biosynthesis and regulation Help us understand plant growth and development Sex determination in maize – creation of double mutants Suitable for production in space…?

19 SuperdwarfWild type GA-deficient superdwarf rice and normal wildtype plants – both types are 21 days old

20 Hormone synthesis Transport of hormone Physiological response The superdwarf mutation occurs in the late steps of GA synthesis. Other mutations occur at other steps, such as in a hormone receptor. These mutants are valuable tools in studying GAs role in plant biology. What experiment could we do to distinguish between these two types of mutation, i.e., synthesis or response?

21 GA exerts its effects on wild type plants – seen here 6 days after treatment with 0 mg/ml or 10 mg/ml GA 0 mg/ml10 mg/ml

22 Superdwarf rice, 6 days after treatment with 10 microliters of 0, 1, and 10 mg/ml Gibberellic Acid (GA) 0 mg/ml1 mg/ml10 mg/ml

23 GA 20 GA 1 GA-3-beta hydroxylase H inactive active A hydroxylase is an enzyme that adds a hydroxyl group (-OH) to a substrate

24 The rice superdwarf mutant (also called Hosetsu- waisei dwarf from the original Japanese description) is caused by a change in the gene encoding a GA- 3 hydroxylase. DNA messenger RNA Deletion of a G residue NORMAL (wildtype)Superdwarf mutant transcription translation Normal, functional proteinThe deletion of a G causes a premature stop codon – so translation ends early and a full normal protein is not made protein

25 Mutant sequence V P G L Q L F R R G P T G G W R C R R W 721 gtcccggggctgcagctgttccgtcgaggcccgaccggtgggtggcggtgccggcggtgg 780 R G P S S S T S A T S S T S S P T A A S 781 cgggggccttcgtcgtcaacgtcggcgacctcttccacatcctcaccaacggccgcttcc 840 T A S T T A P S * T A T A T G S R S A T 841 acagcgtctaccaccgcgccgtcgtgaaccgcgaccgcgaccgggtctcgctcggctact 900 Wildtype sequence V P G L Q L F R R G P D R W V A V P A V 721 gtcccggggctgcagctgttccgtcgagg g cccgaccggtgggtggcggtgccggcggtg 780 A G A F V V N V G D L F H I L T N G R F 781 gcgggggccttcgtcgtcaacgtcggcgacctcttccacatcctcaccaacggccgcttc 840 H S V Y H R A V V N R D R D R V S L G Y 841 cacagcgtctaccaccgcgccgtcgtgaaccgcgaccgcgaccgggtctcgctcggctac 900 Premature STOP codon Shown is a small portion of the rice GA 3 -hydroxylase gene. The G at nucleotide #750 of the gene is deleted in the superdwarf mutant. This causes a change in the amino acids that are encoded after that point. The letters above the DNA sequence are the one-letter abbreviations for the amino acids that are encoded by each triplet codon. absent in mutant

26 Using codon tables to determine amino acid sequences encoded by DNA 736 c t g t t c c g t c g a g g g c c c g a c c g g t g g mRNA c u g u u c c g u c g a _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A.A. L F R R _ _ _ _ _ FLLIFLLI MVMV SPTASPTA Y HQHQ NKNK DEDE C W R SRSR G

27 The experiment: Plant rice seeds – mutant and wildtype. Allow to germinate and then treat with GA at a young age. Can alter volume, concentration, location, plant age, plant species...

28 These mutants, and others like them, have been considered for use in sustaining space travelers (see What properties make these plants potentially useful for space travel? Mutant wildtype Plants of the same age


Download ppt "Plant Hormones Anjali More University of Arkansas."

Similar presentations


Ads by Google