Presentation is loading. Please wait.

Presentation is loading. Please wait.

Figure S1. qPCR analysis of the EMT markers ZEB2 and SNAI1 in Syndecan-1 and control siRNA transfected MDA-MB-231 and MCF-7 cells reveals no significant.

Published byAlan Cummings Modified over 5 years ago

Similar presentations

Presentation on theme: "Figure S1. qPCR analysis of the EMT markers ZEB2 and SNAI1 in Syndecan-1 and control siRNA transfected MDA-MB-231 and MCF-7 cells reveals no significant."— Presentation transcript:

1 Figure S1. qPCR analysis of the EMT markers ZEB2 and SNAI1 in Syndecan-1 and control siRNA transfected MDA-MB-231 and MCF-7 cells reveals no significant expression differences. Data are shown as fold change of expression in Syndecan-1 siRNA treated compared to control siRNA treated cells (n=3, P>0.05 (n.s.)). qPCR was performed essentially as previously described [Ibrahim SA et al. Int J Cancer 131:E ] using the following primers: ZEB2: fw: TGGGCTAGTAGGCTGTGTCCA , rev: TCATCTTCAACCCTGAAACAGAGG; SNAI1: fw:CCTGTTTCCCGGGCAATTTA, rev: TTCTGGGAGACACATCGGTCA.

Download ppt "Figure S1. qPCR analysis of the EMT markers ZEB2 and SNAI1 in Syndecan-1 and control siRNA transfected MDA-MB-231 and MCF-7 cells reveals no significant."

Similar presentations

Knight et al – Supplementary Table Supplemental Table 1: Cell line Densitometry AROSSIRT1 ARPE1965.810.7 WI380.131.9 MCF10A16.751.9 HCT116115.3177.6 HCT116.

Knight et al – Supplementary Table Supplemental Table 1: Cell line Densitometry AROSSIRT1 ARPE WI MCF10A HCT HCT116.
Supplemental Figure 1: ER  expression in MCF-7 cells. MCF-7 cells were either pre-treated with ICI 182,780 (lanes 5-8) or EtOH (vehicle, lanes 1-4) for.

Supplemental Figure 1: ER  expression in MCF-7 cells. MCF-7 cells were either pre-treated with ICI 182,780 (lanes 5-8) or EtOH (vehicle, lanes 1-4) for.
Figure 6. Effect of Withaferin A (WA) treatment on leptin-induced signaling in breast cancer cells. A) Immunoblotting for pSTAT3 (Tyr705), total STAT3,

Figure 6. Effect of Withaferin A (WA) treatment on leptin-induced signaling in breast cancer cells. A) Immunoblotting for pSTAT3 (Tyr705), total STAT3,
Epithelial-to-Mesenchymal Transitions Circulating Tumor Cells

Epithelial-to-Mesenchymal Transitions Circulating Tumor Cells
Figure S2. Syndecan-1 siRNA knockdown reduces LRP-6 expression in membrane fractions of MCF-7 and MDA-MB-231 cells. 2 x 105 MDA-MB-231 or MCF-7 cells were.

Figure S2. Syndecan-1 siRNA knockdown reduces LRP-6 expression in membrane fractions of MCF-7 and MDA-MB-231 cells. 2 x 105 MDA-MB-231 or MCF-7 cells were.
Epithelial-to-Mesenchymal Transitions Circulating Tumor Cells

Epithelial-to-Mesenchymal Transitions Circulating Tumor Cells
Progesterone receptor

Progesterone receptor
Epithelial-to-Mesenchymal Transitions Circulating Tumor Cells

Epithelial-to-Mesenchymal Transitions Circulating Tumor Cells
Supplemental Digital Content 4

Supplemental Digital Content 4
ABAE positive cells 6h after treatment

ABAE positive cells 6h after treatment
A b S1 Fig. Characterization of miR-142-3p expression in human breast cancer cell lines. a) Basal miR-142-3p expression levels relative to MDA-MB-468.

A b S1 Fig. Characterization of miR-142-3p expression in human breast cancer cell lines. a) Basal miR-142-3p expression levels relative to MDA-MB-468.
A B C MDA-MB-231 OHT: h FOXM1 PLK CDC25b ERα Tubulin

A B C MDA-MB-231 OHT: h FOXM1 PLK CDC25b ERα Tubulin
Epithelial-to-Mesenchymal Transitions Circulating Tumor Cells

Epithelial-to-Mesenchymal Transitions Circulating Tumor Cells
a b SUM149PT Motility Invasion C V C V

a b SUM149PT Motility Invasion C V C V
A. D. B. C. - ΔNP63α - β-Actin IMEC - SUM MDA-MB IMEC

A. D. B. C. - ΔNP63α - β-Actin IMEC - SUM MDA-MB IMEC
PI3K isoform–selective inhibitors and PTEN induction decrease ERK phosphorylation. PI3K isoform–selective inhibitors and PTEN induction decrease ERK phosphorylation.

PI3K isoform–selective inhibitors and PTEN induction decrease ERK phosphorylation. PI3K isoform–selective inhibitors and PTEN induction decrease ERK phosphorylation.
GM-CSF induces tumor cell EMT and stemness.

GM-CSF induces tumor cell EMT and stemness.
FL cells are dependent on BCL6 in a NOTCH2-dependent manner.

FL cells are dependent on BCL6 in a NOTCH2-dependent manner.
Regulating Cancer Stem Cells the miR Way

Regulating Cancer Stem Cells the miR Way
Preceding knockdown of FoxO3 reduces inhibitory effect of UCN‐01 on human lung fibroblast proliferation and myofibroblast transdifferentiation in response.

Preceding knockdown of FoxO3 reduces inhibitory effect of UCN‐01 on human lung fibroblast proliferation and myofibroblast transdifferentiation in response.

Similar presentations

Ads by Google