Download presentation
Presentation is loading. Please wait.
Published byElvin Palmer Modified over 7 years ago
2
Mystery of the Matching Marks
3
2
4
For some reason, a GUNSHOT seems to suggest a CRIME SCENE… DO I HAVE YOUR ATTENTION? with BULLETS … and BULLET MARKS …
5
4 How are these marks used to solve crimes?
6
5 They are used to COMPARE bullets found at a crime scene, with bullets that were fired from suspect guns Complete Part One with your teammate and answer the question on your worksheet
7
COMMON ORIGIN !
8
They had a… “COMMON ORIGIN” This is our theme: Matching Complex Patterns = COMMON ORIGIN
13
12 Look at your handout comparing two karyotypes together, showing the matching chromosomes side by side: on the left is a human chromosome on the right is a non-human chromosome COMPARE the CHROMOSOMES what is MOST surprising?
14
13 What is most surprising?
15
Are there any identical ones? 14 What did we say about items with IDENTICAL COMPLEX PATTERNS?
16
15 How would this apply to two different SPECIES with IDENTICAL banding patterns on their CHROMOSOMES? They MUST have a Common Origin, or a COMMON ANCESTOR !
17
16 The clear chromosome evidence of identical banding patterns tells us that humans and chimpanzees must have had a common ancestor The non-human species is the CHIMPANZEE
18
COMMON ANCESTRY 17 Somewhere, in our distant past, there was an ape-like species that gave rise to two lines of ancestry. One branch led to modern CHIMPS, the other branch led to HUMANS. DNA analysis and fossils tell us that this split was around 6-7 million years ago (6-7 mya ) <--- Common Ancestor Chimps Us 6 mya NOW
19
18 And seems to conflict with Traditional Views Is there any other evidence that supports this conclusion?
20
Look at chromosome #4 and #5 How are the two alike? How are they different. See if you can determine the type of mutation that would cause this difference? Cut out the chromosomes and see if you can make them match. Then read the information on your activity sheet.
21
This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT from the human chromosomes (on the left)?
22
21 What is the BIG difference?
23
What could have happened to cause those differences?
24
23 ANY IDEAS that might EXPLAIN the “missing” part of the chimp’s #2 chromosome, AND the chimp’s “extra” chromosome? “Missing” part“Extra” in chimps
25
24 Follow the instructions in PART 4 “Missing” part“Extra” in chimps
26
25 Maybe the chimp’s “extra” chromosome was once part of its short #2. Could the “extra” chromosome match the upper part of our #2? LET’S TRY IT…
27
26 They don’t seem to match. What else could we try? Turn the “extra” one upside down?!
28
27
29
28 They MATCH! “How could this happen?” Was there ONE #2 in our common ancestor, that split to make TWO in chimps, OR Were there TWO short chromosomes in our ancestor that fused (joined) to make ONE in humans? Let’s compare the chromosomes of some other great apes
30
29 The Chromosomes of Humans and Apes Compared For each number, the chromosomes are arranged in this order (left to right): human, chimpanzee, gorilla, orangutan
31
30 PART 5 Follow the instructions on your activity sheet and compare the chromosomes of other apes.
32
31 All the other apes have that “extra” chromosome, too This confirms that the more PRIMITIVE (original) CONDITION is 24 pairs of homologous chromosomes. So our SINGLE #2 chromosome is a DERIVED CONDITION (the result of fusion) How can we TEST that hypothesis?
33
32 We could look for evidence of fusion in the middle of our #2 chromosome… What kind of evidence can we look for? “telomeres”…
34
All Chromosomes have telomeres at both ends (like shoelace aglets!) 33 Head Telomere Centromere Tail Telomere ttagggttagggttagggttagggttagggttaggg… |||||||||||||||||||||||||||||||||||| aatcccaatcccaatcccaatcccaatcccaatccc… Telomeres have a special DNA sequence…
35
34 Head Telomere Centromere Tail Telomere NOTICE: DNA Sequence for Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Did you notice the repeated sequence: ttaggg? “ttaggg” is repeated 800-1600 times in each Telomere
36
35 Here’s another view of a chromosome, showing the telomeres untwisted, and their typical DNA sequence It also shows that the upper (shorter) arm above the centromere is called the “p-arm”, and the lower (longer) arm is called the “q-arm”
37
36 Here are ends of the upper telomeres of the chimp’s “short” chromosome (left)… Short #2“Extra” and its “extra” chromosome (right) TELOMERE DNA CLOSE-UP
38
37 When we turn the “extra” chromosome upside-down, and try to connect it to the “short” chromosome, it only FITS one way (left)… They do NOT fit when one telomere is twisted 180 o (right) NOTICE!
39
38 FURTHERMORE… When we lay the fusion area on its side, we can see more clearly how the DNA sequence changes at the fusion point. Reading the top strand only, see: T T A G G G C C C T A A
40
39 When you are searching the DNA for the Fusion Point you will be looking at only one strand of DNA Look for something like this: …ttagggttagggttagggccctaaccctaaccctaa… Read this like lines of text in a book… Do you see where the multiple g’s (and no c’s) END, and multiple c’s (and no g’s) BEGIN?
41
40 What would this point be called? (where multiple g’s stop, and multiple c’s begin) This would be the FUSION POINT Raise your hand when you see that point in this actual DNA strand below: On which line does the change happen?
42
41 Maybe this will show it more clearly: GOT THE PICTURE? THERE’S the FUSION POINT !
43
42 NOW… WHERE should we LOOK for the FUSION POINT? YES! Right in the MIDDLE of our chromosome #2, where the two matching chimp chromosomes overlap ! 2a 2b
44
43 This would be BELOW the CENTROMERE, in the “q-arm” of the chromosome, in the region known as “2q13”, shown in red. (Can you figure out where the number “2q13” comes from?) 2b 2a
45
44 For “2q13”… 2 = chromosome #2 q = the q-arm 1 = region 1 of that arm 3 = sub-part 3 of that region 2b 2a
46
45 I have gone to an online DNA database and printed out the DNA in that region. So, where can we see the DNA from this region of our #2 chromosome to examine?
47
46 This 2q13 region gives us 52 pages of DNA! This is what a page looks like… On this page, there are 57 lines, each line with 60 bases (letters), and that gives us… 3,420 bases per page!
48
47 If these 52 pages were attached end-to-end, they would stretch about 14 meters (16 yards) around your room! AND… If ALL the DNA from our ENTIRE #2 chromosome was printed out like this, it would stretch about 16 km (10 miles)!
49
48 By the way… Each number on the left edge equals the number of the first base (letter) on that line. And, a space has been inserted after every 10th base (letter) to make counting easier.
50
49 You may notice when you are searching, that the “ttaggg” pattern is not perfect! An occasional “c” slips in here and there, and you will see other minor “glitches.” WHY? If you said “MUTATIONS,” you would be right.
51
50 NOW, it’s YOUR turn! You get to SEARCH those 52 pages! Are you ready??? Just kidding! Actually, you will form teams of 3-4, and each team gets the same page (from the “2q13” region)
52
51 RECAP PROBLEM: How did our #2 chromosome come to look identical to two chromosomes in chimpanzees” TEST: Look for fusion evidence in the form of telomere DNA in the middle of our #2chromosome PREDICTIONS: If hypothesis is true, we should find two telomeres there; If NOT true, should be NO telomeres there. HYPOTHESIS: our #2 chromosome was formed by the fusion of two chromosomes in an ancestor, after chimps branched off. Chimp Us <--Common Ancestor Fusion?
53
52 GO SEARCH for the Tell-Tale Telomeres !
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.