1. Modern Genetics

2. What is DNA? James Watson and Francis Crick pieced together the structure of DNA in the 1950’s. DNA- Dexoyribo Nucleic Acid

3. Structure of DNA DNA is a double helix (twisted ladder) DNA IS THE CODE FOR LIFE It is made up of many repeating nucleotides. A nucleotide is composed of –A phosphate,deoxyribose sugar and base.

4. When you think of a ladder the phosphate and sugars are the sides of the ladder The bases are the rungs (steps)

5. Nitrogenous Base Pairs There are two groups: PurinePyramidines –Adenine (A)Thymine (T) –Guanine (G)Cytosine (C) A’s always match with a T G’s always match with a C AT Garden City –Base pairs are held together by weak hydrogen bonds!!!

6. DNA REPLICATION DNA must copy itself When it replicates it makes a complimentary strand The base pairs match up

8. Replicated StrandDNA strand Replicated Strand P P P P P P P S S S S S S S T G C A G T A S A P S C PP S G S T P S C P S A P S T P

9. From DNA to RNA RNA is RiboNucleic Acid It differs from DNA in 3 ways: –It contains RIBOSE sugar instead of deoxyribose sugar -- It contains URACIL in place of THYMINE A --- U G ---- C -- RNA is Single stranded and DNA is double stranded

10. Transcription Transcription takes place in the nucleus of a cell It is when DNA is used to make a strand of mRNA (messenger RNA) mRNA is necessary for the process of protein synthesis

11. Why is transcription taking place in the nucleus?

12. It takes place in the nucleus because it is made from a strand of DNA which is located in the nucleus. Lets transcribe a piece of DNA into mRNA There are no T’s in mRNA DNAmRNA ATTGCACGTACTGATATTGCACGTACTGAT U A A C G U G C A U G ACAC U A

13. Translation Once the mRNA strand is made in the nucleus it leaves the cell and moves to the cytoplasm. The mRNA is now used to complete translation. Another name for translation is protein synthesis. Protein synthesis takes place at the ribosomes in the cytoplasm.

14. On the strand of mRNA every three letters makes a codon. EX: AUG, CCG, AAG, GAU A codon codes for many different amino acids that exist. See list of amino acids.

15. How do the codons make a protein? At the ribosome the mRNA waits for tRNA (transfer RNA) to transfer over the: –anti-codon (which is opposite the mRNA) –And the appropriate amino acid

16. Animation

17. Mutations: Gene vs. Chromosome Mutations- are changes in the DNA sequence that affect the genetic information –Mutations are not always bad things –Only mutations that occur in gametes can be passed on to the offspring

18. Gene Mutations Gene Mutations result from a change in a single gene. Ex: Point Mutation- mutation that affects one nucleotide Substitutions/Insertion/Deletions all lead to frame shifts.

19. Point Mutation

21. Original- TAC AGT GGC TTA DNA mRNA- AUG UCA CCG AAU Amino Acid: MET SER PRO ASP Substitution: TAC GGT GGC TTA mRNA: AUG CCA CCG AAU Amino MET PRO PRO ASP Acid:

22. Chromosomal Mutations Affect part of the chromosome or all of it. 4 Types: Deletion- a piece of chromosome is lost Duplication- piece is doubled Inversion- a piece goes backwards Translocation- a piece moves to another chromosome

23. Deletion Duplication

24. Inversion: Translocation:

25. Karyotype

26. Heredity and the Environment Environment plays a role in how genes of DNA are expressed. Different portions of DNA express different traits depending on the environment. Ex: Himalayan Rabbits Flowers and pH

28. Genetic Engineering Farmers use different breeding methods to improve livestock Selective Breeding- Mating two organisms with ideal traits to get one organism with the most desirable traits.

29. An Example of Selective Breeding Brahman cattle: Good resistance to heat but poor beef. English shorthorn cattle: Good beef but poor heat resistance. Santa Gertrudis cattle: Formed by crossing Brahman and English shorthorns; has good heat resistance and beef.

30. Recombinant DNA Technology Genetic engineering/recombinant DNA is the process of manipulating genetic instructions of plants and animals to produce new characteristics.

31. Tools for Recombinant DNA Restriction Enzymes- –Enzymes that cut DNA at points where specific nucleotide sequences occur. Plasmids- small circular pieces of DNA found in many bacteria. Gene splicing- combining the two pieces of DNA to form one long molecule.

32. Uses of Recombinant DNA Healthcare purposes –Making insulin genes –Growth hormones –Clotting factors for hemophiliacs More efficient plants and animals for the environment.

33. How it works!!

34. Positives of Genetic Engineering Cost efficient Less side effects from using chemicals to treat certain disorders.