2. Regents Biology 2009-2010 Mutations Changes to DNA

3. Regents Biology Mutations Changes to DNA are called mutations  change the DNA  changes the mRNA  may change protein  may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

4. Regents Biology Types of mutations Changes to the letters (A,C,T,G bases) in the DNA  point mutation change to ONE letter (base) in the DNA may cause change to protein, may not  frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!

5. Regents Biology Point Mutations One base change  can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCARANDTHEREDRATRAN THEFATCATENDTHEREDRATRAN OR Does this change the sentence? A LITTLE!

6. Regents Biology Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop Does this change the protein? DEPENDS…

7. Regents Biology Sickle cell anemia Hemoglobin protein in red blood cells  strikes 1 out of 400 African Americans  limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids

8. Regents Biology Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? Why not? The code has repeats in it!

9. Regents Biology Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop Really destroyed that protein!

10. Regents Biology Frameshift Mutations Add or delete one or more bases  changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR Add one!Delete one! Does this change the sentence? A LOT!

11. Regents Biology Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA Does this change the protein? A LOT!

12. Regents Biology Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA Does this change the protein? A LOT!

13. Regents Biology Significance of Mutations Most are neutral Eye color Birth marks Some are harmful Sickle Cell Anemia Down Syndrome Some are beneficial Sickle Cell Anemia to Malaria Immunity to HIV

14. Regents Biology What Causes Mutations? There are two ways in which DNA can become mutated:  Mutations can be inherited. Parent to child  Mutations can be acquired. Environmental damage Mistakes when DNA is copied

15. Regents Biology Chromosome Mutations Down Syndrome  Chromosome 21 does not separate correctly.  They have 47 chromosomes in stead of 46.  Children with Down Syndrome develop slower, may have heart and stomach illnesses and vary greatly in their degree of inteligence.

16. Regents Biology Chromosome Mutations Cri-du-chat  Deletion of material on 5 th chromosome  Characterized by the cat- like cry made by cri-du- chat babies  Varied levels of metal handicaps

17. Regents Biology Sex Chromosome Mutations Turner’s Syndrome  X  Female  sex organs don't mature at adolescence  sterility  short stature

18. Regents Biology

19. Cystic fibrosis Broken salt channel in cells  strikes 1 in 2500 white births  gene codes for a protein channel that allows salt to flow across cell membrane broken protein doesn’t work as channel doesn’t allow salt out of cell, so water doesn’t flow out either thicker & stickier mucus coating around cells mucus build-ups in lungs & causes bacterial infections destroys lung function  without treatment children die before 5; with treatment can live past their late 20s

20. Regents Biology Deletion leads to Cystic fibrosis deletion Loss of one amino acid!

21. Regents Biology