2. Protein Synthesis and Common DNA 3 rd Six Weeks, 1 st subject (3.1) Notes will be posted on Netschool

3. Standards to be Learned  6 (B) recognize that components that make up the genetic code are common to all organisms  6(C) explain the purpose and process of transcription and translation using models of DNA and RNA  6(D) recognize that gene expression is a regulated process;  6 (E) identify and illustrate changes in DNA and evaluate the significance of these changes;

4. 3.1 Vocabulary  Genetic Code  Sequence  DNA  RNA  Transcription  Translation  Protein Synthesis  Messenger RNA (mRNA)  Transfer RNA (tRNA)  Ribosomal RNA (rRNA)

5. 3.1 Vocabulary  Amino Acid  Codon  Antiocodon  Enzymes  Regulation  Gene Expression  Significance  Mutation  Point mutation  Substitution  Frame-shift mutation

6. Common DNA in all Organisms  DNA (Deoxyribonucleic Acid)  Common to all organisms, regardless of species  Inherited from parents  Controls development and maintenance of organisms  Each DNA molecule is made up of two long chains arranged in a double helix  Each link of a chain is one of four kinds of chemical building blocks called nucleotides and nicknamed A, G, C, and T

7. Common DNA in all Organisms  An organism’s genetic code is its entire set of genetic instructions (also called a genome)  The human genome and those of many other organisms have been sequenced using DNA- sequencing machines  A striking unity underlies the diversity of life  DNA is the universal genetic language common to all organisms  Unity is evident in many features of cell structure  Video: (Discovery Education)  Biology in Focus: What Are DNA and RNA?

8. Protein Synthesis Making Proteins

9.  Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA Bodies  Cells  DNA

10.  How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA  Cells  Bodies

11.  DNA has the information to build proteins  genes DNA  Proteins  Cells  Bodies proteins cells bodies DNA gets all the glory, Proteins do all the work

12. How do proteins do all the work  Proteins  proteins run living organisms  enzymes  control all chemical reactions in living organisms  structure  all living organisms are built out of proteins

13. cytoplasm nucleus Cell organization  DNA  DNA is in the nucleus  genes = instructions for making proteins  want to keep it there = protected  “locked in the vault”

14. Cell organization  Proteins  chains of amino acids  made by a “protein factory” in cytoplasm  protein factory = ribosome nucleus cytoplasm ribosome build proteins

15. Passing on DNA information  Need to get DNA gene information from nucleus to cytoplasm  need a copy of DNA  messenger RNA-Carries information out of the nucleus to the ribosome nucleus cytoplasm ribosome mRNA build proteins

16. mRNA From nucleus to cytoplasm DNA transcription nucleus cytoplasm translation trait protein

17. DNA vs. RNA DNA  deoxyribose sugar  nitrogen bases  G, C, A, T  T : A  C : G  double stranded RNA  ribose sugar  nitrogen bases  G, C, A, U  U : A  C : G  single stranded

18. Transcription  Making mRNA from DNA  DNA strand is the template (pattern)  match bases  U : A  G : C  Enzyme  RNA polymerase

19. Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

20. Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

21. Matching bases of DNA & RNA  Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A

22. Matching bases of DNA & RNA  U instead of T is matched to A TACGCACATTTACGTACGCGG DNA A AUGCGUGUAAAUGCAUGCGCC mRNA UCCCCCCAAUGUGAAAAAGGGGUU ribosome

23. protein cytoplasm nucleus trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome

24. How does mRNA code for proteins  mRNA leaves nucleus  mRNA goes to ribosomes in cytoplasm  Proteins built from instructions on mRNA aa How? mRNA UCCCCCCAAUGUGAAAAAGGGGUU

25. How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? aa

26. Warm-up Question 12/2/2014  What do we call a block of three bases of mRNA?

27.  For ALL life!  strongest support for a common origin for all life  Code has duplicates  several codons for each amino acid  mutation insurance!  Start codon  AUG  methionine  Stop codons  UGA, UAA, UAG The mRNA code

28. How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA anti-codon codon tRNA UAC Met GCA Arg CAU Val  Anti-codon = block of 3 tRNA bases amino acid

29. mRNA to protein = Translation  The working instructions  mRNA  The reader  ribosome  The transporter  transfer RNA (tRNA) mRNA UCCCCCCAAUGUGAAAAAGGGGUU aa tRNA GG U aa tRNA UAC aa tRNA GA C aa AGU ribosome

30. aa mRNA From gene to protein DNA transcription nucleus cytoplasm protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome tRNA aa

31. protein transcription cytoplasm nucleus translation trait

32. From gene to protein transcription translation protein

33. Get your Tablets Out!  Do the transcription and translation exercises located here: http://learn.genetics.utah.edu/content/molecules/transcribe/

34. 12/4/2014 Warm-Up Place the following events of protein synthesis in the correct order: a. mRNA attaches to a ribosome, which reads the mRNA b. DNA serves as template for mRNA production c. tRNA anti-codon bonds to codon d. Amino acids bond together e. RNA moves from nucleus to cytoplasm Answer: B  E  A  C  D

35. What is a gene and what is Gene Expression?  A Gene is the molecular unit of heredity in a living organism!  Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins.

36. Gene Expression

37. Operons  Gene expression requires an operons!  A segment of DNA to which a transcription factor can bind!  Also called a lac operon  The operon regulates gene expression!

38. Control of Gene Expression  Cells differ in which genes are being expressed  It is based on cell function (nerve vs muscle)  Levels of control in eukaryotes  Transcriptional  Post transcriptional  Translational  Post translational  May rely on signals from outside or inside the cell!

39. Types of Control  Transcriptional control  Determines the rate of transcription or if transcription even occurs  The organization of chromatin (form that chromosomes take in non-dividing cells)  Regulator proteins are called transcription factors  Signals from inside/outside cell

40. Types of Control  Post transcriptional  Involves process of mRNA  Translational control  Involves the ability of the mRNA to bind to ribosomes  Post translational  Involves changes needed for the polypeptide to become functional  Polypeptide: long, continuous chain of amino acids

41. MUTATIONS Changes in DNA that affect genetic information

42. Don’t let this happen to you!!

43. Gene Mutations  Point Mutations – changes in one or a few nucleotides  Substitution  THE FAT CAT ATE THE RAT  THE FAT HAT ATE THE RAT  Insertion  THE FAT CAT ATE THE RAT  THE FAT CAT XLW ATE THE RAT  Deletion  THE FAT CAT ATE THE RAT  THE FAT ATE THE RAT

44. Gene Mutations  Frameshift Mutations – shifts the reading frame of the genetic message so that the protein may not be able to perform its function.  Insertion  THE FAT CAT ATE THE RAT  THE FAT HCA TAT ETH ERA T  Deletion  THE FAT CAT ATE THE RAT  TEF ATC ATA TET GER AT H H

45. Chromosome Mutations  Changes in number and structure of entire chromosomes  Original Chromosome ABC * DEF  DeletionAC * DEF  DuplicationABBC * DEF  InversionAED * CBF  TranslocationABC * JKL GHI * DEF

46. Significance of Mutations Most are neutral Eye color Birth marks Some are harmful Sickle Cell Anemia Down Syndrome Some are beneficial Sickle Cell Anemia to Malaria Immunity to HIV

47. What Causes Mutations?  There are two ways in which DNA can become mutated:  Mutations can be inherited.  Parent to child  Mutations can be acquired.  Environmental damage  Mistakes when DNA is copied

48. Chromosome Mutations  Down Syndrome  Chromosome 21 does not separate correctly.  They have 47 chromosomes in stead of 46.  Children with Down Syndrome develop slower, may have heart and stomach illnesses and vary greatly in their degree of inteligence.

49. Chromosome Mutations  Cri-du-chat  Deletion of material on 5 th chromosome  Characterized by the cat- like cry made by cri-du- chat babies  Varied levels of metal handicaps

50. Sex Chromosome Abnormalities  Klinefelter’s Syndrome  XXY, XXYY, XXXY  Male  Sterility  Small testicles  Breast enlargement

51. Sex Chromosome Abnormalities  XYY Syndrome  Normal male traits  Often tall and thin  Associated with antisocial and behavioral problems

52. Sex Chromosome Mutations  Turner’s Syndrome  X  Female  sex organs don't mature at adolescence  sterility  short stature

53. Sex Chromosome Mutations  XXX  Trisomy X  Female  Little or no visible differences  tall stature  learning disabilities  limited fertility