1. Deoxyribonucleic Acid DNA Structure & Replication

2. Transformation Of Bacteria Two Strains Of Streptococcus Capsules Smooth Strain (Virulent) Rough Strain (Harmless)

3. Experimental Transformation Of Bacteria The Griffith Experiment - Control + Control - Control OUCH!

4. Bacterial colonies Rough nonvirulent (strain R) Injection Results Mouse healthy Smooth virulent (strain S) Mouse dies Heat-killed smooth virulent (strain S) Live strain S bacteria in blood sample from dead mouse Mouse dies Mouse healthy + Rough nonvirulent (strain R) Heat-killed smooth virulent (strain S) Griffith’s experiment identifying the “transforming principle”

5. Questions That Were Asked? What caused the transformation? What caused the transformation? What are the four things found in all living organisms? What are the four things found in all living organisms? How can we test for the factor responsible for transforming “R” bacteria into “S” bacteria? How can we test for the factor responsible for transforming “R” bacteria into “S” bacteria? Are there molecular machines capable of removing specific “factors” from the mix without affecting others? Are there molecular machines capable of removing specific “factors” from the mix without affecting others?

6. Microbiologist Avery led the team that showed that DNA is the unit of Inheritance. One Nobel laureate has called the discovery "the historical platform of modern DNA research", and his work inspired Watson and Crick to seek DNA's structure. Oswald Avery (1877-1955)

7. Avery, MacLeod and McCarty 1944 Avery, MacLeod and McCarty repeated Griffith’s 1928 experiment with modifications designed to discover the “transforming factor” 1944 Avery, MacLeod and McCarty repeated Griffith’s 1928 experiment with modifications designed to discover the “transforming factor” Extracts from heat killed cells were digested with hydrolytic enzymes specific for different classes of macro molecules: Extracts from heat killed cells were digested with hydrolytic enzymes specific for different classes of macro molecules: NoNuclease YesProtease YesLippase Transformation?Enzyme YesSaccharase

8. What is the “transforming principle”? - Conclusion: DNA is the transforming principle allowing R bacteria to make a smooth coat and allow infection. Oswald Avery, Colin MacLeod and Maclyn McCarty, 1944 - Heat-killed S bacteria “transformed” the R bacteria to a form that causes pneumonia

9. Phages Infecting a bacterium

10. The Hershey-Chase Experiement The Hershey-Chase experiment showed definitively that DNA is the genetic material The Hershey-Chase experiment showed definitively that DNA is the genetic material Hershey and Chase took advantage of the fact that T2 bacteriophage is made of only two classes of macromolecules: Protein and DNA Hershey and Chase took advantage of the fact that T2 bacteriophage is made of only two classes of macromolecules: Protein and DNA H OH P O HO O NH 2 Nucleotides contain phosphorous, thus DNA contains phosphorous, but not sulfur. H OH O H2NH2NCC CH 2 SHSH H OH O H2NH2NC CH 3 C CH 2 S Some amino acids contain sulfur, thus proteins contain sulfur, but not phosphorous. CysteineMethionine

11. Figure 16.2a The Hershey-Chase experiment: phages

12. Figure 16.2b The Hershey-Chase experiment

13. Summary Griffith: Transforming principle produced genetic change. Griffith: Transforming principle produced genetic change. Avery: Transforming principle is DNA. Avery: Transforming principle is DNA. Hershey-Chase: Genetic material of phage is DNA. Hershey-Chase: Genetic material of phage is DNA.

14. What is DNA? Long thin double strands composed of subunits called nucleotides Long thin double strands composed of subunits called nucleotides The nucleotides are linked in a chain The nucleotides are linked in a chain

15. DNA Nucleotide O O=P-O OPhosphate Group Group N Nitrogenous base (A, G, C, or T) (A, G, C, or T) CH2 O C1C1 C4C4 C3C3 C2C2 5 5 Carbon Sugar (deoxyribose)

16. Nucleotides Have 3 Parts Phosphate group Phosphate group 5 carbon sugar (deoxyribose) 5 carbon sugar (deoxyribose) Phosphates and sugar form the backbone of DNA Phosphates and sugar form the backbone of DNA Nitrogen base – 4 types Nitrogen base – 4 types Adenine Adenine Guanine Guanine Thymine Thymine Cytosine Cytosine

17. Nitrogenous Bases PURINES: double rings of carbon and nitrogen PURINES: double rings of carbon and nitrogen 1.Adenine (A) 2.Guanine (G) PYRIMIDINES: single rings of carbon and nitrogen PYRIMIDINES: single rings of carbon and nitrogen 3.Thymine (T) 4.Cytosine (C) T or C A or G

18. Chargaff discovered the pairing rules of DNA letters, noticing that A Matches to T and C to G. He found that no matter the organism, the amounts of A were always similar to the amount of T. Similarly, the amounts of C equaled the concentration of G. Chargaff’s Rules Erwin Chargaff (1905-2002)

19. Chargaff’s Rules Base pair rule: Base pair rule: A=T A=T G=C G=C

20. Franklin, trained as a chemist, was expert in deducing the structure of molecules by firing X-rays through them. Her images of DNA - disclosed without her knowledge - put Watson and Crick on the track towards the right structure. She went on to do pioneering work on the structures of viruses.. Rosalind Franklin (1920-58) First Glimpse of DNA

21. Rosalind Franklin and her X-ray diffraction photo of DNA First Glimpse of DNA

22. Like Crick, New Zealand-born Wilkins trained as a physicist, and was involved with the Manhattan project to build the nuclear bomb. Wilkins worked on X-ray crystallography of DNA with Franklin at King's College London, although their relationship was strained. He helped to verify Watson and Crick's model, and shared the 1962 Nobel with them. Maurice Wilkins (1916- )

23. The Double Helix Watson and Crick (1953) discovered the structure of DNA to be a double helix or “spiral staircase” of two strands of nucleotides twisting around a central axis. Watson and Crick (1953) discovered the structure of DNA to be a double helix or “spiral staircase” of two strands of nucleotides twisting around a central axis. Names for DNA…double helix, twisted staircase Names for DNA…double helix, twisted staircase

24. DNA Double Helix Nitrogenous Base (A,T,G or C) “Rungs of ladder” “Legs of ladder” Phosphate & Sugar Backbone

25. DNA Double Helix

26. BASE-PAIRINGS Base # of Purines PyrimidinesPairs H-Bonds Adenine (A) Thymine (T)A = T 2 Guanine (G) Cytosine (C)C G 3 CG 3 H-bonds

27. Chargaff’s Rule Adenine must pair with Thymine and the reverse Adenine must pair with Thymine and the reverse Guanine must pair with Cytosine and the reverse Guanine must pair with Cytosine and the reverse Their amounts in a given DNA molecule will be about the same. Their amounts in a given DNA molecule will be about the same. G C TA

28. DNA Double Helix P P P O O O 1 2 3 4 5 5 3 3 5 P P P O O O 1 2 3 4 5 5 3 5 3 G C TA

29. Example ACTGCCGAATTGACGGCTTA

30. Chargaff’s Rules Base pairing rules show the arrangement of nucleotides within a DNA molecule Base pairing rules show the arrangement of nucleotides within a DNA molecule Base pairs of DNA form a double helix and are complementary to each other Base pairs of DNA form a double helix and are complementary to each other Chargaff was the scientist who discovered that A and T along with C and G always occurred in the same proportions within DNA Chargaff was the scientist who discovered that A and T along with C and G always occurred in the same proportions within DNA

31. BASE-PAIRINGS CG H-bonds T A

32. Question: If there is 30% Adenine, how much Cytosine is present? If there is 30% Adenine, how much Cytosine is present?

33. Answer: There would be 20% Cytosine. There would be 20% Cytosine. Adenine (30%) = Thymine (30%) Guanine (20%) = Cytosine (20%) (50%) = (50%) (50%) = (50%)

34. How DNA is copied…DNA Replication Replication is the process of synthesizing a new strand of DNA Replication is the process of synthesizing a new strand of DNA When does this occur? …before cell division When does this occur? …before cell division Prior to replication, double helix must be unwound Prior to replication, double helix must be unwound This is done by an enzyme called helicase This is done by an enzyme called helicase Helicase breaks up the hydrogen bonds that link the bases Helicase breaks up the hydrogen bonds that link the bases

37. How DNA is copied…DNA Replication The point at which the DNA separates is called the replication fork (y shape) The point at which the DNA separates is called the replication fork (y shape) At the replication fork, new enzymes known as DNA polymerases move along each new strand adding nucleotides to exposed bases- forming two new double helices At the replication fork, new enzymes known as DNA polymerases move along each new strand adding nucleotides to exposed bases- forming two new double helices DNA polymerases “proofread” to prevent errors DNA polymerases “proofread” to prevent errors Typically, there are many replication forks along each linear DNA molecule Typically, there are many replication forks along each linear DNA molecule

38. Semi-conservative Replication Half of original DNA strand is “conserved” or used in the new strand. Half of original DNA strand is “conserved” or used in the new strand.

39. Two enzymes to know: Helicase – breaks the hydrogen bonds between bases to unwind the DNA Helicase – breaks the hydrogen bonds between bases to unwind the DNA DNA polymerases – bring new nucleotides into place, proofreads new strands as they form DNA polymerases – bring new nucleotides into place, proofreads new strands as they form