1. The expression of inflammatory cytokines in chemical- or microkeratome-assisted corneal epithelial flaps in rabbits Taehyung Lim, MD 1,2,4, Hyuk- Jin Choi MD 1,2, Hyun Joo Lee 1,2, Mee Kum Kim, MD 1,2, Won Ryang Wee, MD 1,2, Jin Hak Lee, 2,3 Department of Ophthalmology, Seoul National University Hospital 1, Seoul, Korea Seoul Artificial Eye Center, Seoul National University Hospital Clinical Research Institute 2, Seoul, Korea Department of Ophthalmology, Bundang Seoul National University Hospital 3, Seoul, Korea HanGil Eye Hospital 4, Incheon, Korea Authors have not any financial support

2. Purpose To compare the expression of inflammatory cytokines in chemical- or microkeratome-assisted corneal epithelial flaps in rabbit animal models.

3. Subject & Methods 40 eyes of 20 New Zealand White rabbits Bilateral study Corneal epithelial flap(diameter of 5.0 mm) was made using the following ways:  Group A ; 1. A pplication of 20% alcohol for 30 seconds, 2 or 3 times 2. Corneal epithelial flap was made using a micro hoe (Katena, U.S.) 3. The flap was replaced  Group B ; 1.The flap was made using epimicrokeratome(Amadeus, 나라 Hz) 2. The flap was replaced

4. All the eyes wore therapeutic contact lenses and received tarsorrhaphies Eyes were enucleated at 3 days after the procedure Tissue sections were stained with H&E and immunohistochemistry (MMP-9, TNF-alpha) (hamster anti mouse TNF-alpha : Santa Cruz, sc-12744, mouse anti MMP-9, Chemicon, MAB3309) IL-6, TNF-alpha were evaluated by RT-PCR and were compared between those two groups. (Rabbit TNF-a ; Forward PRIMER : atggtcaccctcagatcagc Reverse PRIMER : ttgaccgctgaagagaacct, Rabbit IL-6 ; Forward PRIMER : tcctggagaccatcaaggagReverse PRIMER : gggtggcttcttcattcaaa )

5. Results H&E stain showed more irregular arrangement of epithelial basal cells in Group A than in Group B NormalGroup AGroup B

6. RT-PCR - The expression level of mRNA of IL-6, MMP-9, TNF- alpha showed no significant difference between those two groups Mean ± SD

7. Immunohistochemistry MMP-9 Negative Control, x 200Positive Control, x 200

8. MMP-9 (x 200) Group A Group B

9. Immunohistochemistry TNF-alpha Negative Control, x 200Positive Control, x 200

10. TNF-alpha (x400) Group A Group B

11. MMP-9 and TNF-alpha were expressed and were more prominent than negative control tissue in all groups There was no significant difference between two groups

12. Conclusion The expression of inflammatory cytokines in epimicrokeratome- assisted flap might be no different from alcohol-assisted flap, suggesting that the inflammatory response of the cornea might be similar between Epi-LASIK and LASEK.