1. Arrowsmith extensions to bio-informatics Vetle I. Torvik

2. Discovering new gene sequences 4 Start with a novel DNA sequence 4 find overlapping sequences within the expressed sequence tag (EST) database  find others that overlap with that one, until one has identified an entire new full-length gene ATGATAGGAGA GGAGAGCTGAGA TGAGATGCGCTG CGCTGATACTAGA CTAGATGATAGAGATGCC ATGATAGGAGAGCTGAGATGCGCTGATACTAGATGATAGAGATGCC

3. The Arrowsmith approach applied to nucleotide or protein sequences 4 begin with two different sets A and C of sequences that do not overlap 4 search for sequences B in the database that overlap with one or more sequences in both A and C AB 1 B 1 BC 1 ATGCTCTCGCGCTACGACTAGCATACTG ACTGATCGCTAGCTATGA ATCGACAAGCTATGTGCAACTG CCTGATCGCTACTACTAGCTGA TCTCGCTACTAGATCACTAGCTTA CTCGATGAGCGATGATCGCTAGCTATGGG ATCTGATACTAGCTACGACTAGC GTGAGGATCGCGATGATGATG

4. Linking to microarray experimental data 4 A = set of microarray experiments that measured reelin 4 C = set of microarray experiments that measured tooth development 4 A and C might be in the same or different databases 4 B-terms = genes whose expression was correlated with reelin in some system, and that were expressed during tooth developing on the other 4 If reelin regulates certain genes that have roles during tooth development, one may hypothesize a role for reelin in tooth development as well, even if none of the tooth microarray studies had examined reelin explicitly

5. This might stimulate someone to test... 4 if reelin is expressed at specific times and places within the developing toothbud 4 if reelin actively regulates the genes on the B-list 4 if tooth development is abnormal in the reeler mouse that genetically lacks reelin

6. Linking PubMed to bio- informatics databases PubMed A-literature PubMed C-literature Microarray gene A Microarray gene C B-gene list

7. Other databases 4 Genomic 4 Quantitative trait loci (QTL) 4 Atlases 4 Images 4 ETC

8. Using the literature to link genes 4 If genes A strongly co-occurs with gene B in the literature due to a biologically significant relationship, and 4 gene B and C similarly co-occur, 4 Then genes A and C are likely to be biologically related as well 4 When A and C do not co-occur above the chance level, then the relation between A and C may not be previously known or documented

9. 4 Special case of the Arrowsmith 1-node search Gene B Gene CGene A 0.9 0.2