1. Single nucleotide polymorphisms and Large scale variation
Lecture-6
Single nucleotide polymorphisms and Large scale variation
Huseyin Tombuloglu, Phd
GBE423 Genomics & Proteomics

2. How can we identify and study all the genetic changes that occur in so many different diseases?
How can we explain why some people respond to treatment and not others?

3. ‘SNP’ is the answer to these questions…
So what exactly are SNPs?
How are they involved in so many different aspects of health?

4. What is SNP ?
A SNP is defined as a single base change in a DNA sequence that occurs in a significant proportion (more than 1 percent) of a large population.

5. Some Facts In human beings, 99.9 percent bases are same.
Remaining 0.1 percent makes a person unique.
Different attributes / characteristics / traits
how a person looks,
diseases he or she develops.

6. These variations can be:
Harmless (change in phenotype)
Harmful (diabetes, cancer, heart disease, Huntington's disease, and hemophilia )
Latent (variations found in coding and regulatory regions, are not harmful on their own, and the change in each gene only becomes apparent under certain conditions e.g. susceptibility to lung cancer)

7. SNP facts SNPs are found in Occur with a very high frequency
coding and (mostly) noncoding regions.
Occur with a very high frequency
about 1 in 1000 bases to 1 in 100 to 300 bases.
The abundance of SNPs and the ease with which they can be measured make these genetic variations significant.
SNPs close to particular gene acts as a marker for that gene.
SNPs in coding regions may alter the protein structure made by that coding region.

8. SNPs may / may not alter protein structure

9. Types of genetic variation
Substitutions
ACTGACTGACTGACTGACTG
ACTGACTGGCTGACTGACTG
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Variations (SNVs)
Insertions/deletions (INDELS)
ACTGACTGACTGACTGACTGACTG
Copy Number Variants (CNVs)
Indels > 1Kb in size

10. SNPs vs. SNVs Really a matter of frequency of occurrence
Both are concerned with aberrations at a single nucleotide
SNP
Aberration expected at the position for any member in the species (well-characterized)
Occur in population at some frequency so expected at a given locus
Validated in population
Catalogued in dbSNP (
SNV
Aberration seen in only one individual (not well characterized)
Occur at low frequency so not common
Not validated in population
9/12/2012
Variant Calling

11. Human genetic variation
Variation can have an effect on function
Non-synonymous substitutions can change the amino acid encoded by a codon or give rise to premature stop codons
Indels can cause frame-shifts
Mutations may affect splice sites or regulatory sequence outside of genes or within introns

12. Identifying a causative de novo mutation
Veltman and colleagues - Nat Genet Dec;42(12):
(1) Sequence genome
(2) Select only coding mutations
MSGTCASTTR
MSGTNASTTR
Patient with idiopathic disorder
~22,000 variants
(exome re-sequencing)
~5,640 coding variants
(4) Sequence parents and exclude their private variants
(3) Exclude known variants seen in healthy people
~143 novel coding variants
(5) Look at affected gene function and mutational impact
~5 de novo novel coding variants
For 6/9 patients, they were able to identify a single likely-causative mutation

13. Catalogs of human genetic variation
The 1000 Genomes Project
SNPs and structural variants
genomes of about 2500 unidentified people from about 25 populations around the world will be sequenced using NGS technologies
HapMap
identify and catalog genetic similarities and differences
dbSNP
Database of SNPs and multiple small-scale variations that include indels, microsatellites, and non-polymorphic variants
COSMIC
Catalog of Somatic Mutations in Cancer
9/12/2012
Variant Calling

16. SNP or Mutation? Call it a SNP IF Call it a mutation IF
the single base change occurs in a population at a frequency of 1% or higher.
Call it a mutation IF
the single base change occurs in less than 1% of a population.
A SNP is a polymorphic position where the point mutation has been fixed in the population.

17. From a Mutation to a SNP

18. SNPs Classification Intergenic region Gene region
SNPs can occur anywhere on a genome, they are classified based on their locations.
Intergenic region
Gene region
can be further classified as promoter region, and coding region (intronic, exonic, promoter region, UTR, etc.)

19. Coding Region SNPs
Synonymous: do not result in a change of amino acid in the protein, but still can affect its function in other ways
Non-Synonymous
Missense – amino acid change
Nonsense – changes amino acid to stop codon.
Geospiza Green Arrow™ tutorial by Sandra Porter, Ph.D.

21. Synonymous
An example would be a seemingly silent mutation in the multidrug resistance gene 1 (MDR1), which codes for a cellular membrane pump that expels drugs from the cell, can slow down translation and allow the peptide chain to fold into an unusual conformation, causing the mutant pump to be less functional
Missense
 (e.g. c.1580G>T SNP in LMNA gene - position 1580 (nt) in the DNA sequence (CGT codon) causing the guanine to be replaced with the thymine, yielding CTT codon in the DNA sequence, results at the protein level in the replacement of the arginine by theleucine in the position 527, at the phenotype level this manifests in overlapping mandibuloacral dysplasia and progeria syndrome
Nonsense
e.g. Cystic fibrosis caused by the G542X mutation in the cystic fibrosis transmembrane conductance regulator gene

22. The Consequences of SNPs
The phenotypic consequence of a SNP is significantly affected by the location where it occurs, as well as the nature of the mutation.
No consequence
Affect gene transcription quantitatively or qualitatively.
Affect gene translation quantitatively or qualitatively.
Change protein structure and functions.
Change gene regulation at different steps.

23. Simple/Complex Genetic Diseases and SNPs
Simple genetic diseases (Mendelian diseases) are often caused by mutations in a single gene.
-- e.g. Huntington’s, Cystic fibrosis, PKU, etc.
Many complex diseases are the result of mutations in multiple genes, the interactions among them as well as between the environmental factors.
-- e.g. cancers, heart diseases, Alzheimer's, diabetes, asthmas, etc.
Majority of SNPS may not directly cause any diseases.
SNPs are ideal genomic markers (dense and easy to assay) for locating disease loci in association studies.

25. A single base mutation in the APOE (apolipoprotein E) gene is associated with a higher risk for Alzheimer's disease
A single SNP may cause a Mendelian disease, though for complex diseases, SNPs do not usually function individually, rather, they work in coordination with other SNPs to manifest a disease condition as has been seen in Osteoporosis
rs6311 and rs6313 are SNPs in the Serotonin 5-HT2A receptor gene on human chromosome 13.
rs  is an example of a triallelic SNP in the CRP gene on human chromosome 1.
TAS2R38 codes for PTC tasting ability, and contains 6 annotated SNPs.

26. Main Genetic Variation Resources
NCBI dbSNP
NCBI Online Mendelian Inheritance in Man (OMIM)
International HapMap Project
Perlegen
Genome Variation Server (Seattle SNPs)