1. Genomes

2. Definition an organism‘s complete set of DNA
Complete set of instructions for making an organism
master blueprints for all enzymes, cellular structures & activities
an organism‘s complete set of DNA
total genetic information carried by a single set of chromosomes in a haploid nucleus

3. Viral genomes
Viral genomes: ssRNA, dsRNA, ssDNA, dsDNA, linear or circular
Viruses with RNA genomes:
Almost all plant viruses and some bacterial and animal viruses
Genomes are rather small (a few thousand nucleotides)
Viruses with DNA genomes (e.g. lambda = 48,502 bp):
Often a circular genome.
Replicative form of viral genomes
all ssRNA viruses produce dsRNA molecules
many linear DNA molecules become circular
Molecular weight and contour length:
duplex length per nucleotide = 3.4 Å
Mol. Weight per base pair = ~ 660

4. Agrobacterium tumefaciens
Procaryotic genomes
Generally 1 circular chromosome (dsDNA)
Usually without introns
Relatively high gene density (~2500 genes per mm of E. coli DNA)
Often indigenous plasmids are present
Eschericia coli
Agrobacterium tumefaciens

5. Bacterial genomes: E. coli
4288 protein coding genes:
Average ORF 317 amino acids
Average gene size 1000 bp
Very compact: average distance between genes 118bp
Contour length of genome: 1.7 mm

6. Easy problem Bacterial Gene-finding
Dense Genomes
Short intergenic regions
Uninterrupted ORFs
Conserved signals
Abundant comparative information
Complete Genomes

7. Plasmids Extra chromosomal circular DNAs -lactamase ori
Found in bacteria, yeast and other fungi
Size varies form ~ 3,000 to 250,000 bp.
Replicate autonomously (origin of replication)
May contain resistance genes
May be transferred from one bacterium to another
May be transferred across kingdoms
Multipcopy plasmids (~ up to 400 plasmids/per cell)
Low copy plasmids (1 –2 copies per cell)
Plasmids may be incompatible with each other
used as vectors that could carry a foreign gene of interest
foreign gene

8. Agrobacterium tumefaciens
Characteristics
Plant parasite that causes Crown Gall Disease
Lives in intercellular spaces of the plant
Encodes a large (~250kbp) plasmid called Tumor-inducing (Ti) plasmid)
Plasmid contains genes responsible for the disease
Wound = entry point  days later, tumor forms
Portion of the Ti plasmid is transferred between bacterial cells and plant cells  T-DNA (Tumor DNA)

9. Agrobacterium tumefaciens
Characteristics
T-DNA integrates stably into plant genome
Single stranded T-DNA fragment is converted to dsDNA fragment by plant cell
Then integrated into plant genome
2 x 23bp direct repeats play an important role in the excision and integration process

10. Agrobacterium tumefaciens
What is naturally encoded in T-DNA?
Enzymes for auxin and cytokinin synthesis
Causing hormone imbalance  tumor formation/undifferentiated callus
Mutants in enzymes have been characterized
Opine synthesis genes (e.g. octopine or nopaline)
Carbon and nitrogen source for A. tumefaciens growth
Insertion genes
Virulence (vir) genes
Allow excision and integration into plant genome

11. Ti plasmid of A. tumefaciens

12. Auxin, cytokinin, opine synthetic genes transferred to plant
Plant makes all 3 compounds
Auxins and cytokines cause gall formation
Opines provide unique carbon/nitrogen source only A. tumefaciens can use!

13. Fungal genomes: S. cerevisiae
First completely sequenced eukaryote genome
Very compact genome:
Short intergenic regions
Scarcity of introns
Lack of repetitive sequences
Strong evidence of duplication:
Chromosome segments
Single genes
Redundancy: non-essential genes provide selective advantage

14. Eucaryotic genomes Located on several chromosomes
Relatively low gene density (50 genes per mm of DNA in humans)
Carry organellar genome as well

15. 2300 Mbp=??? Human Genomes 50,000 genes X 2 kbp=100 Mbp
Introns=300 Mbp?
Regulatory regions=300 Mbp?
Only 5-10% of human genome codes for genes
- function of other DNA (mostly repetitive sequences) unknown
but it might serve structural or regulatory roles
2300 Mbp=???

16. Plant genomes Plant contains three genomes
Genetic information is divided in the chromosome.
The size of genomes is species dependent
The difference in the size of genome is mainly due to a different number of identical sequence of various size arranged in sequence
The gene for ribosomal RNAs occur as repetitive sequence and together with the genes for some transfer RNAs in several thousand of copies
Structural genes are present in only a few copies, sometimes just single copy. Structural genes encoding for structurally and functionally related proteins often form a gene family
The DNA in the genome is replicated during the interphase of mitosis

17. Plant genomes: Arabidopsis thaliana
A weed growing at the roadside of central Europe
It has only 2 x 5 chromosomes
It is just 70 Mbp
It has a life cycle of only 6 weeks
It contains 25,498 structural genes from 11,000 families
The structural genes are present in only few copies sometimes just one protein
Structural genes encoding for structurally and functionally related proteins often form a gene family

18. Peculiarities of plant genomes
Huge genomes reaching tens of billions of base pairs
Numerous polyploid forms
Abundant (up to 99%) non coding DNA which seriously hinders sequencing, gene mapping and design of gene contigs
Poor morphological, genetics, and physical mapping of chromosomes
A large number of “small-chromosome” in which the chromosome length does not exceed 3 μm
The difficulty of chromosomal mapping of individual genes using in situ hybridization
The number of chromosomes and DNA content in many species is still unknown

19. Size of the genome in plants and in human
Arabidopsis thaliana
Zea mays
Vicia faba
Human
Nucleus
70 Millions
3900 Millions
14500 Millions
2800 Millions
Plastid
0.156 Millions
0.136 Millions
0.120 Millions
Mitochondrion
0.370 Millions
.570 Millions
.290 Millions
.017 Millions

20. Organisation of the genome into chromosome
The nuclear genome is organized in to chromosome
Chromosomes consist of essentially one long DNA helix wound around nucleosome
At metaphase, when the genome is relatively inactive, the chromosome are most condensed and therefore most easily observed cytologically, counted or separated
Chromosomes provide the means by which the plant genome constituents are replicated and segregated regularly in mitosis and meiosis
Large genome segments are defined by their conserved order of constituent genes

21. Chromosome

22. Chromosome parts Heterochromatin
Darkly staining portions of chromosomes, believed due to high degree of coiling
a. Centromere
~ “middle” of Chromosomes
spindle attachment sites
b. Telomeres
1. ends of chromosome
2. important for the stability of
chromosomes tips.
2. Euchromatin
Lightly staining portion of chromosomes
It represents most of the genomes
It contains most of genes.

23. Genome organization

24. Segment of DNA which can be transcribed and translated to amino acid
Protein Coding Genes
Segment of DNA which can be transcribed and translated to amino acid 40

25. Protein Coding Genes Transcribed region ≈ Open Reading Frame (ORF)
long (usually >100 aa)
“known” proteins  likely
Basal signals
Transcription, translation
Regulatory signals
Depend on organism
Prokaryotes vs Eukaryotes
Yeast, ~1% of genes have ORFs<100 aa

26. Protein Coding Genes House keeping gene:
Plant contains about – structural genes
They are present in only a few copies, sometimes just one (single copy gene)
They often form a gene family
The transcription of most structural genes is subject to very complex and specific regulation
The gene for enzymes of metabolism or protein biosynthesis which proceed in all cells are transcribed more often
Most of the genes are switched off and are activated only in certain organ and then often only in certain cells
Many genes are only switched on at specific times
Yeast, ~1% of genes have ORFs<100 aa
House keeping gene:
The genes which every cell needs for such basic functions independent of its specialization

27. Prokaryotic Gene Promoter Cistron1 Cistron2 CistronN Terminator
Transcription
RNA Polymerase
mRNA 5’ 3’ 1 2 N
Translation
Ribosome, tRNAs,
Protein Factors N N C N C C 1 2 3
Polypeptides

28. Promoter Region on DNA upstream from transcription start site
initial binding site of RNA polymerase and initiation factors (IFs)
Promoter recognition: a prerequisite for initiation
E. coli consensus promoter regions
-35 site = TTGACA
-10 site: “TATA” box

29. Eukaryotic genes

30. Pseudogenes Nonfunctional copies of genes
Formed by duplication of ancestral gene, or reverse transcription (and integration)
Not expressed due to mutations that produce a stop codon (nonsense or frame-shift) or prevent mRNA processing, or due to lack of regulatory sequences

31. Tandemly Repeated DNA
A large number of identical repeated DNA sequences
It spread over the entirely chromosome
There is therefore within species variation for the number of copies in allelic arrays
Variations in the lengths of tandemly repeat units have been used as a sources of molecular marker
It is divided into:
1. Tandemly repeated expressed DNA
2. Tandemly repeated non expressed DNA

32. Tandemly Repeated Gene
Genes which are duplicated and clustered at many location of the genome
Ribosomal 18S, 58S, 25S and 5S RNA genes are highly reiterated in clusters and form at sites called nucleolus organizers (NOR)
There is therefore within species variation for the number of copies in allelic arrays
Variations in the lengths of rDNA repeat units have been used as a sources of molecular marker
Tandem repeated expressed DNAs are also observed for tDNA and histones

33. Tandemly Repeat non expressed DNA
Repetitive sequences which are unable to be expressed but found in huge amount in the genome
Simple-sequence DNA
Moderately repeated DNA (mobile DNA)

34. Simple Sequence DNA
Very sort sequences repeated many times in tandem in large clusters
It is also called as satellite DNA
It often lies in heterochromatin especially in centromeres and telomeres (and others)
It is divided into 2 groups:
Mini satellite : Variable number tandem repeat (VNTR)
Micro satellite : Simple sequence repeat (SSR)
It is used in DNA fingerprinting to identify individuals

35. Mobile DNA
Units of DNA which are predisposed to move to another location, sometimes involving replication of the unit, with the help of products of genes on the elements or on related element
Move within genomes
Most of moderately repeated DNA sequences found throughout higher eukaryotic genomes
L1 LINE is ~5% of human DNA (~50,000 copies)
Alu is ~5% of human DNA (>500,000 copies)
Some encode enzymes that catalyze movement
2 types:
a. Transposon
b. Retrotransposon

36. Transposon
Chromosomal loci capable of being transposed from one spot to another within and among the chromosomes of a complement gene
Movement of mobile DNA
Involves copying of mobile DNA element and insertion into new site in genome
Why?
Molecular parasite: “selfish DNA”
Probably have significant effect on evolution by facilitating gene duplication, which provides the fuel for evolution, and exon shuffling

37. Retrotransposon (retroelement)
Transposon like segment of DNA
Retroviruses lacking the sequence encoding the structural envelope protein
Major component of plant genome
Size ranges from 1 to 13 kb in length
Widely distributed over the chromosomes of many plant species gene
Retrovirus
A virus of higher organism whose genome is rna, but which can insert a dna copy its genome into host chromosome

38. The Repetitive DNA Content of Genomes

39. Tandemly repeated DNA Microsatellite Minisatellite
Unit size: at most 5 bp
ATATATATATATATATATATATAT
Minisatellite
Unit size: up to 25 bp
ATTGCTGTATTGCTGTATTGCTGT

40. Interspersed Genome-wide Repeats
Retrotransposon
RNA intermediate
Retrovirus,
LTR retrotransposon (Long terminal repeat),
Non-LTR retrotransposon,
LINEs (Long interspersed element)
SINEs (Short interspersed element)
Transposon
DNA intermediate

41. Classification of transposable elements

42. Retrotransposon

43. Structural feature of transposable elements
SINEs ( bp)
AAAAA
LINEs (6-8 kbp)
Orf1
pol
AAAAA
Retrotransposon (4-8 kbp)
gag
pol
LTR
LTR
Endogenous Retrovirus (4-8 kbp)
gag
pol
env
LTR
LTR

44. Life cycle of LTR retrotransposons
IN, integrase; PR, protease; RT, reverse transcriptase; VLP, virus-like particle

45. Eukaryotic cells
Peter J. Russell, iGenetics: Copyright © Pearson Education, Inc., publishing as Benjamin Cummings.

46. Mitochondrial genome (mtDNA)
Number of mitochondria in plants can be between
One mitochondria consists of 1 – 100 genomes (multiple identical circular chromosomes. They are one large and several smaller
Size ~15 Kb in animals
Size ~ 200 kb to 2,500 kb in plants
Mt DNA is replicated before or during mitosis
Transcription of mtDNA yielded an mRNA which did not contain the correct information for the protein to be synthesized. RNA editing is existed in plant mitochondria
Over 95% of mitochondrial proteins are encoded in the nuclear genome.
Often A+T rich genomes

47. Chloroplast genome (ctDNA)
Multiple circular molecules, similar to procaryotic cyanobacteria, although much smaller ( %of the size of nuclear genomes)
Cells contain many copies of plastids and each plastid contains many genome copies
Size ranges from 120 kb to 160 kb
Plastid genome has changed very little during evolution. Though two plants are very distantly related, their genomes are rather similar in gene composition and arrangement
Some of plastid genomes contain introns
Many chloroplast proteins are encoded in the nucleus (separate signal sequence)

48. “Cellular” Genomes Viruses Procaryotes Eucaryotes
Nucleus
Capsid
Plasmids
Viral genome
Bacterial
chromosome
Chromosomes
(Nuclear genome)
Mitochondrial
genome
Chloroplast
genome
Genome: all of an organism’s genes plus intergenic DNA
Intergenic DNA = DNA between genes

49. Estimated genome sizes
mammals
plants
fungi
bacteria (>100)
mitochondria (~ 100)
viruses (1024)
1e1 1e2 1e e4 1e5 1e6 1e7 1e8 1e9 1e10 1e11 1e12
Size in nucleotides. Number in ( ) = completely sequenced genomes

50. What Did These Individuals Contribute to Molecular Genetics?
Anton van Leeuwenhoek
Discovered cells
Bacteria
Protists
Red blood

51. What Did These Individuals Contribute to Molecular Genetics?
Gregor Johan Mendel
Discovered genetics

52. What Did These Individuals Contribute to Molecular Genetics?
Walter Sutton
Discovered Chromosomes

53. What Did These Individuals Contribute to Molecular Genetics?
Thomas Hunt Morgan
Discovered how genes are transmitted through chromosomes

54. What Did These Individuals Contribute to Molecular Genetics?
Rosalind Elsie Franklin
Research led to the discovery of the double helix structure of DNA

55. What Did These Individuals Contribute to Molecular Genetics?
James Watson and Francis Crick
Discovered DNA

56. DNA’s History 1866 Gregore Mendel Law of Heredity 1900
Carl Correns, Hugo de Vries& Eric von Tschermak
Mendelian Law re-invention
1944
Avery, Macleod & McCarty
Gene consists of DNA
1952
Hersey dan Chase
DNA as genetic matarials
1953
Watson & Crick
Double helix DNA
1971
Cohen & Boyer
Transformation Technology
1972
Berg
DNA Recombinant Technology
1973
Arber, smith & Nathans
Restriction Enzyme

57. Gene
The hereditary determinant of a specified difference between individual
The unit of heredity
The unit which passed from generation to generation following simple Mendelian inheritance
A segment of DNA which encodes protein synthesis
Any of the units occurring at specific points on the chromosomes, by which hereditary characters are transmitted and determined, and each is regarded as a particular state of organization of the chromatin in the chromosome, consisting primarily DNA and protein

58. Gene classification intergenic region non-coding genes coding genes
Chromosome
(simplified)
Messenger RNA
Structural RNA
Proteins
transfer
RNA
ribosomal
RNA
other
RNA
Structural proteins
Enzymes

59. What are the problems with this definition?
Gene
Molecular definition:
DNA sequence encoding protein
What are the problems with this definition?

60. Gene Some genomes are RNA instead of DNA
Some gene products are RNA (t-RNA, r-RNA, and others) instead of protein
Some nucleic acid sequences that do not encode gene products (non-coding regions) are necessary for production of the gene product (RNA or protein)

61. Coding region
Nucleotides (open reading frame) encoding the amino acid sequence of a protein
The molecular definition of gene includes more than just the coding region

62. Noncoding regions of eukaryotic gene
Regulatory regions
RNA polymerase binding site
Transcription factor binding sites
Introns
Polyadenylation [poly(A)] sites

63. Molecular definition:
Gene
Molecular definition:
Entire nucleic acid sequence necessary for the synthesis of a functional polypeptide (protein chain) or functional RNA

64. Polycistronic mRNA encodes several proteins
Bacterial genes
Most do not have introns
Many are organized in operons: contiguous genes, transcribed as a single polycistronic mRNA, that encode proteins with related functions
Polycistronic mRNA encodes several proteins

65. Bacterial operon

66. Eukaryotic genes Most have introns Produce mono-cistronic mRNA
(only one encoded protein)
Large

67. Hemoglobin beta subunit gene
Eucaryotic genes
Hemoglobin beta subunit gene
Exon 1
90 bp
Intron A
131 bp
Exon 2
222 bp
Intron B
851 bp
Exon 3
126 bp
Splicing
Introns : intervening sequences within a gene that are not translated into a
protein sequence.
Exons : sequences within a gene that encode protein sequences
Splicing : Removal of introns from the mRNA molecule.

68. mRNA from some genes can be spliced into two or more different mRNAs
Alternative splicing
mRNA from some genes can be spliced into two or more different mRNAs

69. Number of genes in eukaryotes
Species # genes
S. cerevisiae (yeast) ~6700
D. melanogaster (fruit fly) ~14400
C. elegans (roundworm) ~20600
A. thaliana (mustard weed) ~25000
H. sapiens (human) ~24000
P. troglodytes (chimpanzee) ~22500
M. musculus (mouse) ~27000
R. norvegicus (rat) ~23400
C. familiaris (dog) ~20400

70. Top Ten Terms in Molecular Genetics
Amino acids: the 20 building blocks of proteins, each coded for by a specific 3 base-pair codon.
Allele: one of the two copies of a specific gene
Polymorphism: a gene that varies between individual members of the population in more than 1% of the population. Most commonly, these are single nucleotide variations (SNPs).
Transcription: the synthesis of an RNA copy from a sequence of DNA; the first step in gene expression.
Translation: the synthesis of proteins from mRNA and amino acids

71. Top Ten Terms in Molecular Genetics
Gene: specific sequence of nucleotide bases that carries information for constructing proteins; exons are the regions that actually encode for the protein
Chromosome: physically separate microscopic units of DNA that comprise the genome
Genetics: the study of the patterns of inheritance of specific traits
Genomics: the study of an organism’s entire complement of genetic material and its function
Proteomics: the study of an organism’s entire protein material, its structure and function