1. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 4 Lecture PowerPoint

2. 2 Type Course Number Here: Type Course Name Here Chapter 4 Type Professor Name Here Type Academic Rank Here Type Department Name Here Type Institution Name Here

3. 3 Hole’s Human Anatomy and Physiology Twelfth Edition Shier  Butler  Lewis Chapter 4 Cellular Metabolism Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

4. 4 Important Points in Chapter 4: Outcomes to be Assessed 4.1: Introduction Define metabolism. Explain why protein synthesis is important. 4.2: Metabolic Processes Compare and contrast anabolism and catabolism. Define dehydration synthesis and hydrolysis. 4.3: Control of Metabolic Reactions Describe how enzymes control metabolic reactions. List the basic steps of an enzyme-catalyzed reaction. Define active site.

5. 5 Important Points in Chapter 4: Outcomes to be Assessed Define a rate-limiting enzyme and indicate why it is important in a metabolic pathway. 4.4: Energy for Metabolic Reactions Explain how ATP stores chemical energy and makes it available to a cell. State the importance of the oxidation of glucose. 4.5: Cellular Respiration Describe how the reactions and pathways of glycolysis, the citric acid cycle, and the electron transport chain capture the energy in nutrient molecules. Discuss how glucose is stored, rather than broken down.

6. 6 Important Points in Chapter 4: Outcomes to be Assessed 4.6: Nucleic Acids and Protein Synthesis Define gene and genome. Describe the structure of DNA, including the role of complementary base pairing. Describe how DNA molecules replicate. Define genetic code. Compare DNA and RNA. Explain how nucleic acid molecules (DNA and RNA) carry genetic information. Define transcription and translation. Describe the steps of protein synthesis.

7. 7 Important Points in Chapter 4: Outcomes to be Assessed 4.7: Changes in Genetic Information Compare and contrast mutations and SNPs. Explain how a mutation can cause a disease. Explain two ways that mutations originate. List three types of genetic changes. Discuss two ways that DNA is protected against mutation.

8. 8 4.1: Introduction Metabolic processes – all chemical reactions that occur in the body There are two (2) types of metabolic reactions: Anabolism Larger molecules are made from smaller ones Requires energy Catabolism Larger molecules are broken down into smaller ones Releases energy

9. 9 4.2: Metabolic Processes Consists of two processes: Anabolism Catabolism

10. 10 Anabolism Anabolism provides the materials needed for cellular growth and repair Dehydration synthesis Type of anabolic process Used to make polysaccharides, triglycerides, and proteins Produces water CH 2 OH H H OH O H Monosaccharide + H HO H OH H H O H Monosaccharide H HO H OH H H O H Disaccharide H2OH2O Water + H HO HH H OH O H H O H Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. CH 2 OH

11. Amino acid N H H CC H R Dipeptide molecule++ Peptide bond Amino acid N H H CC H H H R H O N H H CC H R H O N H CCOH R H O O N H H CC H R N H CC R H O O Water Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. OO H2OH2O 11 Anabolism HC H Glycerol3 fatty acid molecules + OHHO HCOHHO HC C C COHHO H O O C C C O O O HC H Fat molecule (triglyceride) + HC HCO O O H 3 water molecules (CH 2 ) 14 CH 3 H2OH2O H2OH2O H2OH2O Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. O

12. 12 Catabolism Catabolism breaks down larger molecules into smaller ones Hydrolysis A catabolic process Used to decompose carbohydrates, lipids, and proteins Water is used to split the substances Reverse of dehydration synthesis CH 2 OH H H OH O H Monosaccharide + H HO H OH H H O H Monosaccharide H HO H OH H H O H Disaccharide H2OH2O Water + H HO HH H OH O H H O H Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. CH 2 OH

13. Catabolism Amino acid N H H CC H R Dipeptide molecule++ Peptide bond Amino acid N H H CC H H H R H O N H H CC H R H O N H CCOH R H O O N H H CC H R N H CC R H O O Water Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. OO H2OH2O HC H Glycerol3 fatty acid molecules + OHHO HCOHHO HC C C COHHO H O O C C C O O O HC H Fat molecule (triglyceride) + HC HCO O O H 3 water molecules (CH 2 ) 14 CH 3 H2OH2O H2OH2O H2OH2O Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. O 13

14. 14 4.3: Control of Metabolic Reactions Enzymes Control rates of metabolic reactions Lower activation energy needed to start reactions Most are globular proteins with specific shapes Not consumed in chemical reactions Substrate specific Shape of active site determines substrate Product molecule Active site (a) (b)(c) Substrate molecules Unaltered enzyme molecule Enzyme-substrate complex Enzyme molecule Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

15. 15 Animation: How Enzymes Work Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

16. 16 Enzyme Action Metabolic pathways Series of enzyme-controlled reactions leading to formation of a product Each new substrate is the product of the previous reaction Enzyme names commonly: Reflect the substrate Have the suffix – ase Examples: sucrase, lactase, protease, lipase Substrate 1 Enzyme A Substrate 2 Enzyme B Substrate 3 Enzyme C Substrate 4 Enzyme D Product Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

17. 17 Cofactors and Coenzymes Cofactors Make some enzymes active Non-protein component Ions or coenzymes Coenzymes Organic molecules that act as cofactors Vitamins

18. 18 Factors That Alter Enzymes Factors that alter enzymes: Heat Radiation Electricity Chemicals Changes in pH

19. 19 Regulation of Metabolic Pathways Limited number of regulatory enzymes Negative feedback Inhibition Substrate 1 Substrate 2 Enzyme B Substrate 3 Enzyme C Substrate 4 Enzyme D Product Rate-limiting Enzyme A Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

20. 20 4.4: Energy for Metabolic Reactions Energy is the capacity to change something; it is the ability to do work Common forms of energy: Heat Light Sound Electrical energy Mechanical energy Chemical energy

21. 21 ATP Molecules Each ATP molecule has three parts: An adenine molecule A ribose molecule Three phosphate molecules in a chain Energy transferred and utilized by metabolic reactions when phosphate bond is broken Energy transferred from cellular respiration used to reattach phosphate P PP P PPP Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

22. 22 Release of Chemical Energy Chemical bonds are broken to release energy We burn glucose in a process called oxidation

23. 23 4.5: Cellular Respiration Occurs in a series of reactions: 1.Glycolysis 2.Citric acid cycle (aka TCA or Kreb’s Cycle) 3.Electron transport system

24. 24 Cellular Respiration Produces: Carbon dioxide Water ATP (chemical energy) Heat Includes: Anaerobic reactions (without O 2 ) - produce little ATP Aerobic reactions (requires O 2 ) - produce most ATP

25. 25 Glycolysis Series of ten reactions Breaks down glucose into 2 pyruvic acid molecules Occurs in cytosol Anaerobic phase of cellular respiration Yields two ATP molecules per glucose molecule Summarized by three main phases or events: 1. Phosphorylation 2. Splitting 3. Production of NADH and ATP

26. 26 Glycolysis Event 1 - Phosphorylation Two phosphates added to glucose Requires ATP Event 2 – Splitting (cleavage) 6-carbon glucose split into two 3-carbon molecules Phase 1 priming Phase 2 cleavage Phase 3 oxidation and formation of ATP and release of high energy electrons 2 ADP 2 NADH + H + 2 NAD + 2 NADH + H + 2 NAD + P ATP PP P Glyceraldehyde phosphate Glucose Dihydroxyacetone phosphate 2 4 ADP ATP 4 Fructose-1,6-diphosphate O2O2 2 Pyruvic acid 2 Lactic acid To citric acid cycle and electron transport chain (aerobic pathway) Carbon atom Phosphate P P Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. O2O2

27. 27 Glycolysis Event 3 – Production of NADH and ATP Hydrogen atoms are released Hydrogen atoms bind to NAD + to produce NADH NADH delivers hydrogen atoms to electron transport system if oxygen is available ADP is phosphorylated to become ATP Two molecules of pyruvic acid are produced Two molecules of ATP are generated Phase 1 priming Phase 2 cleavage Phase 3 oxidation and formation of ATP and release of high energy electrons 2 ADP 2 NADH + H + 2 NAD + 2 NADH + H + 2 NAD + P ATP PP P Glyceraldehyde phosphate Glucose Dihydroxyacetone phosphate 2 4 ADP ATP 4 Fructose-1,6-diphosphate O2O2 2 Pyruvic acid 2 Lactic acid To citric acid cycle and electron transport chain (aerobic pathway) Carbon atom Phosphate P P Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. O2O2

28. 28 Anaerobic Reactions If oxygen is not available: Electron transport system cannot accept new electrons from NADH Pyruvic acid is converted to lactic acid Glycolysis is inhibited ATP production is less than in aerobic reactions Phase 1 priming Phase 2 cleavage Phase 3 oxidation and formation of ATP and release of high energy electrons 2 ADP 2 NADH + H + 2 NAD + 2 NADH + H + 2 NAD + P ATP PP P Glyceraldehyde phosphate Glucose Dihydroxyacetone phosphate 2 4 ADP ATP 4 Fructose-1,6-diphosphate O2O2 2 Pyruvic acid 2 Lactic acid To citric acid cycle and electron transport chain (aerobic pathway) Carbon atom Phosphate P P Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. O2O2

29. 29 Aerobic Reactions If oxygen is available: Pyruvic acid is used to produce acetyl CoA Citric acid cycle begins Electron transport system functions Carbon dioxide and water are formed 34 molecules of ATP are produced per each glucose molecule ATP 2 2 Glucose Pyruvic acid Acetyl CoA CO 2 2 CO 2 Citric acid O 2 H 2 O 2e – + 2H + Electron transport chain ATP 32-34 Cytosol Mitochondrion High energy electrons (e – ) and hydrogen ions (H + ) High energy electrons (e – ) and hydrogen ions (h + ) Oxaloacetic acid High energy electrons (e – ) and hydrogen ions (H + ) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

30. 30 Citric Acid Cycle Begins when acetyl CoA combines with oxaloacetic acid to produce citric acid Citric acid is changed into oxaloacetic acid through a series of reactions Cycle repeats as long as pyruvic acid and oxygen are available For each citric acid molecule: One ATP is produced Eight hydrogen atoms are transferred to NAD + and FAD Two CO 2 produced Citric acid cycle ADP + ATP Pyruvic acid from glycolysis Citric acid (start molecule) Acetyl CoA (replenish molecule) Acetic acid Oxaloacetic acid (finish molecule) Isocitric acid CO 2 2 2 Succinyl-CoASuccinic acid FAD FADH 2 Fumaric acid Malic acid Cytosol Mitochondrion NADH + H + NAD + NADH + H + NAD + NADH + H + NAD + CoA P NADH + H + NAD + P CoA Carbon atom Phosphate Coenzyme A -Ketoglutaric acid Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

31. 31 Electron Transport System ATPADP + ATP synthase Electron transport chain Energy P 2H + + 2e – 2e – 2H + NADH + H + NAD + 2H + + 2e – FADH 2 FAD O 2 H2OH2O Energy Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. NADH and FADH2 carry electrons to the ETS ETS is a series of electron carriers located in cristae of mitochondria Energy from electrons transferred to ATP synthase ATP synthase catalyzes the phosphorylation of ADP to ATP Water is formed

32. 32 Summary of Cellular Respiration Glycolysis Cytosol Mitochondrion ATP2 Glucose High-energy electrons (e – ) 2e – and 2H + ATP2 H 2 OO 2 ATP32–34 CO 2 Pyruvic acid 2 CO 2 Acetyl CoA Citric acid Oxaloacetic acid 1 3 4 2 Glycolysis The 6-carbon sugar glucose is broken down in the cytosol into two 3-carbon pyruvic acid molecules with a net gain of 2 ATP and release of high-energy electrons. Citric Acid Cycle The 3-carbon pyruvic acids generated by glycolysis enter the mitochondria. Each loses a carbon (generating CO 2 and is combined with a coenzyme to form a 2-carbon acetyl coenzyme A (acetyl CoA). More high-energy electrons are released. Each acetyl CoA combines with a 4-carbon oxaloacetic acid to form the 6-carbon citric acid, for which the cycle is named. For each citric acid, a series of reactions removes 2 carbons (generating 2 CO 2 ’s), synthesizes 1 ATP, and releases more high-energy electrons. The figure shows 2 ATP, resulting directly from 2 turns of the cycle per glucose molecule that enters glycolysis. Electron Transport Chain The high-energy electrons still contain most of the chemical energy of the original glucose molecule. Special carrier molecules bring the high-energy electrons to a series of enzymes that convert much of the remaining energy to more ATP molecules. The other products are heat and water. The function of oxygen as the final electron acceptor in this last step is why the overall process is called aerobic respiration. Electron transport chain Citric acid cycle Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

33. 33 Carbohydrate Storage Carbohydrate molecules from foods can enter: Catabolic pathways for energy production Anabolic pathways for storage

34. 34 Carbohydrate Storage Excess glucose stored as: Glycogen (primarily by liver and muscle cells) Fat Converted to amino acids Hydrolysis Monosaccharides Energy + CO 2 + H 2 OGlycogen or Fat Amino acids Carbohydrates from foods Catabolic pathways Anabolic pathways Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

35. 35 Summary of Catabolism of Proteins, Carbohydrates, and Fats High energy electrons carried by NADH and FADH 2 Breakdown of simple molecules to acetyl coenzyme A accompanied by production of limited ATP and high energy electrons H2OH2O 2e – and 2H + Waste products –NH 2 CO 2 Citric acid cycle Electron transport chain Amino acids Acetyl coenzyme A Simple sugars (glucose) GlycerolFatty acids Proteins (egg white) Carbohydrates (toast, hashbrowns) Food Fats (butter) Pyruvic acid ATP Breakdown of large macromolecules to simple molecules Glycolysis 1 2 3 ATP Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. © Royalty Free/CORBIS. ½ O 2 High energy electrons carried by NADH and FADH 2 Complete oxidation of acetyl coenzyme A to H 2 O and CO 2 produces high energy electrons (carried by NADH and FADH 2 ), which yield much ATP via the electron transport chain Breakdown of simple molecules to acetyl coenzyme A accompanied by production of limited ATP and high energy electrons H2OH2O 2e – and 2H + Waste products –NH 2 CO 2 Citric acid cycle Electron transport chain Amino acids Acetyl coenzyme A Simple sugars (glucose) GlycerolFatty acids Proteins (egg white) Carbohydrates (toast, hashbrowns) Food Fats (butter) Pyruvic acid ATP Breakdown of large macromolecules to simple molecules Glycolysis 1 2 3 ATP © Royalty Free/CORBIS. ½ O 2

36. 36 4.6: Nucleic Acids and Protein Synthesis Instruction of cells to synthesize proteins comes from a nucleic acid, DNA

37. 37 Genetic Information Gene – segment of DNA that codes for one protein Genetic information – instructs cells how to construct proteins; stored in DNA Genome – complete set of genes Genetic Code – method used to translate a sequence of nucleotides of DNA into a sequence of amino acids

38. 38 4.1 From Science to Technology DNA Profiling Frees A Prisoner

39. 39 Structure of DNA Two polynucleotide chains Hydrogen bonds hold nitrogenous bases together Bases pair specifically (A-T and C-G) Forms a helix DNA wrapped about histones forms chromosomes G C G G A T C C A P G C P T P P C G P G P C P A P P P Thymine (T) Cytosine (C) Adenine (A) Guanine (G) Nucleotide strand Globular histone proteins Metaphase chromosome Segment of DNA molecule Chromatin (a) Hydrogen bonds (b) (c) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

40. 40 Animation: DNA Structure Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

41. 41 DNA Replication Hydrogen bonds break between bases Double strands unwind and pull apart New nucleotides pair with exposed bases Controlled by DNA polymerase Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. C C AT C CG G C C G C G A A T T CG C AT Newly formed DNA molecules Region of replication Original DNA molecule G G G G G G GG G CC C C CG A A A T T A A T T T T T A A A TA A T

42. 42 Animation: DNA Replication Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

43. 43 4.2 From Science to Technology Nucleic Acid Amplification

44. 44 Genetic Code Specification of the correct sequence of amino acids in a polypeptide chain Each amino acid is represented by a triplet code

45. 45 RNA Molecules Transfer RNA (tRNA): Carries amino acids to mRNA Carries anticodon to mRNA Translates a codon of mRNA into an amino acid Ribosomal RNA (rRNA): Provides structure and enzyme activity for ribosomes Messenger RNA (mRNA): Making of mRNA (copying of DNA) is transcription

46. 46 RNA Molecules Messenger RNA (mRNA): Delivers genetic information from nucleus to the cytoplasm Single polynucleotide chain Formed beside a strand of DNA RNA nucleotides are complementary to DNA nucleotides (exception – no thymine in RNA; replaced with uracil) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DNARNA S G S C S S S S C G T A S S S S G C A U Direction of “reading” code P P P P P P P P P P

47. 47 Animation: Stages of Transcription Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

48. 48 Animation: How Translation Works Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

49. 49 Protein Synthesis Messenger RNA 1DNA information is copied, or transcribed, into mRNA following complementary base pairing 2mRNA leaves the nucleus and attaches to a ribosome 3Translation begins as tRNA anticodons recognize complementary mRNA codons, thus bringing the correct amino acids into position on the growing polypeptide chain 4As the ribosome moves along the mRNA, more amino acids are added 5At the end of the mRNA, the ribosome releases the new protein 6 Amino acids attached to tRNA Polypeptide chain Cytoplasm DNA double helix DNA strands pulled apart Transcription (in nucleus) Translation (in cytoplasm) Nucleus C Codon 1 Codon 2 Codon 3 Codon 4 Codon 5 Codon 6 Codon 7 G G G G G A A A U U C C C C C C G G G A Methionine Glycine Amino acids represented Serine Alanine Threonine Alanine Glycine DNA strand Messenger RNA A T A A T T T AT AT AT AT AT UA UA UA G C C GC GC G C GC GC G C G G C C GC CG U A CG C G G G G G G G G G G C C C C C C C C C C A A A A A T TA AT AT AT AT CG GC GC GC TA TA TA CG AT GC TA CG TA CG CG GC AT TA CG GC T T G CG CG CG CG CG CG CG C G Nuclear pore tRNA molecules can pick up another molecule of the same amino acid and be reused Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. G C CG A G G C U C T C C G A G

50. 50 Protein Synthesis Next amino acid Anticodon Codons Growing polypeptide chain 1 1 2 2 3 3 4 4 5 5 6 6 7 C U G G Ribosome 1 1 2 2 3 3 7 4 4 5 5 67 C C CGU CUGCGU Next amino acid Anticodon Codons 1 1 2 2 3 3 4 4 5 5 6 6 7 Peptide bond CUGCGU CCGCGU 6 Messenger RNA Transfer RNA Next amino acid 1 1 2 2 3 3 4 4 5 5 67 6 7 UCGGAAAAAAGGGGGGGGCCCCCCCUU UCGGAAAAAAGGGGGGGGCCCCCCCUU UCGGAAAAAAGGGGGGGGCCCCCCCUU UCGGAAAAAAGGGGGGGGCCCCCCCUU The transfer RNA molecule for the last amino acid added holds the growing polypeptide chain and is attached to its complementary codon on mRNA. A second tRNA binds complementarily to the next codon, and in doing so brings the next amino acid into position on the ribosome. A peptide bond forms, linking the new amino acid to the growing polypeptide chain. The tRNA molecule that brought the last amino acid to the ribosome is released to the cytoplasm, and will be used again. The ribosome moves to a new position at the next codon on mRNA. A A new tRNA complementary to the next codon on mRNA brings the next amino acid to be added to the growing polypeptide chain. 2 1 3 4 Messenger RNA Transfer RNA Next amino acid Transfer RNA Messenger RNA Transfer RNA Growing polypeptide chain Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

51. 51 Animation: Protein Synthesis Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

52. 64 codons code for 20 amino acids 52

53. 53 4.3 From Science to Technology MicroRNAs and RNA Interference

54. 54 4.7: Changes in Genetic Information Only about 1/10 th of one percent of the human genome differs from person to person

55. 55 Nature of Mutations Mutations – change in genetic information Result when: Extra bases are added or deleted Bases are changed May or may not change the protein Code for glutamic acid Mutation Direction of “reading” code Code for valine (a)(b) S S S C T A P P P S S S C T T P P P Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

56. 56

57. 57 Protection Against Mutation Repair enzymes correct the mutations

58. 58 Inborn Errors of Metabolism Occurs from inheriting a mutation that then alters an enzyme This creates a block in an otherwise normal biochemical pathway

59. 59 4.4 From Science to Technology The Human Metabolome

60. 60 Quiz 4 Complete Quiz 4 now! Read Chapter 5.