1. www.grimmy.com/

2. Transcription & Translation

3. Transcription : writing again Translation : changing languages

4. Today we’ll go from here... To here Text

5. Off to see the wizard... DNA replication –both strands => new DNA –=> new cell Transcription –1 strand => new RNA –=> new protein Sending ‘messages’ out from DNA

6. 20 toys EVERY one has a blue part. Chem name? EVERY one has a red part. Chem name? Thus these are all…? How many are there?

7. Amino Acids How are they similar? How are they different? What do the differences mean in terms of “feel”? How many are there? Possible?

8. Amino Acids You & partner have an amino acid; which is it? (StructViewer or homepage => left column ‘big twenty’ amino acids)

9. Nucleic Acids How are they similar? How are they different? What do the differences mean in terms of “feel”? Which is more diverse in terms of shape and ‘feel’? Which would allow for more diverse shapes and surfaces when ‘connected’?

10. How does a codon ‘mean’ an amino acid?

11. The Play is the thing…

12. Or, Fun With Blocks

13. The Play is the thing… ‘Types of Bonds’ –Velcro – can be easily broken/re-made during lab –Duct tape – breaking it gets you and zero (0) for this week’s quiz

14. The Play is the thing… The Players

15. The Play is the thing… The Players –tRNA

16. The Play is the thing… The Players –tRNA –Ribosome

17. The Play is the thing… The Players –tRNA –Ribosome –Aminoacyl tRNA synthetase

18. The Play is the thing… The Players –tRNA –Ribosome –Aminoacyl tRNA synthetase –RNA polymerase

19. The Play is the thing… The Players –tRNA (4 people) –Ribosome (1) –Aminoacyl tRNA synthetase (4) –RNA polymerase (1-2) * and RNA –Termination factor (1)

20. Blinding you with Science (jargon) RNA Polymerase: joins RNA links into a chain mRNA: messenger RNA; RNA string copied (‘transcribed’) from DNA tRNA: transfer RNA; one of many RNA molecules that carry specific amino acids ribosome: giant machine (>200 proteins, 4 RNAs (2 > 1000 nucleotides) that oversees the reading of the mRNA and the creation of polypeptide aminoacyl tRNA synthetase: protein machine adds amino acid to tRNAs Termination factor: ‘reads’ UAA etc., => ribosome looses the peptide & falls apart

21. Learning your ‘lines’ Handout: Each group find questions related to their role; answer them Lab manual, textbook, internet OK as sources Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts 5’ end is pointy/spiky 3’ end is soft/furry

22. DNA Template 5’ CTTAAATCCGAATGCCCATG 3’ 5’ is “sticky”, 3’ is “fuzzy”

23. 5’ CTTAAATCCGAATGCCCATG 3’ 5’ is “sticky”, 3’ is “fuzzy”

24. Wielding the Power ‘Recall’ that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!

25. Ready…. Go! mRNA at the central bench ribosome assembles around it synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA) tRNAs will ‘diffuse’ by following a path through the room When any event first happens*, action stops, molecules involved will announce, explain Go until a protein happens

26. “Who” knows what’s going on? What happens if a tRNA carries the wrong amino acid? What happens if the mRNA contains a copy error relative to DNA? What happens if a tRNA has a mutated anticodon

27. Exit Condition 1.) Pair up (two in a group) 2.) Write your names and SECTION at the top of the paper 3.) EXPLAIN the process of TRANSLATION Include the following in your answer: tRNA mRNA Ribosome AUG codon RNA polymerase Aminoacyl tRNA synthetase Termination factor diffusion

28. Meet your new best friend

29. Protocol: (1)Put a ½ inch layer of milk into a picnic plate (2) Add a drop of each of several food colorings at different locations towards the perimeter (3) Touch a wooden stick to a dab of dishwashing detergent (4) Touch the detergent to the center of the milk (5) Observe!

30. WHAT DID YOU SEE? -Hypothesize: What all is going on? How can you test your hypothesis?