1. Molecular characterization of Fusarium fujikuroi associated with bakanae disease of rice in India Dr. Bishnu Maya Bashyal Scientist Division of Plant Pathology ICAR-Indian Agricultural Research Institute, New Delhi-110012 ICAR -Indian Agricultural Research Institute

2. Bakanae: an emerging disease of rice in India  Rice (Oryza sativa L.) is one of the most important food crops of India. Total area under rice production is 43.64 million hectares with the production of 97 million tones. India is the largest producer and exporter of basmati rice in the world.  About 70% of basmati rice is produced in India, where, it shares 7.76 million hectares with production of 71.10 lakhs tonnes and contributes 15449.6 crores in rice export.  Bakanae disease of rice is emerging as a potential threat in India (Anonymous, 2007). High incidence of bakanae disease has been observed in Pusa-1121, Pusa-1509, Pusa-2511, CSR- 30, Dehradoon Basmati and Pakistani Basmati (Anonymous, 2013).  In India, bakanae disease had been considered as of minor importance earlier and work has been carried out only on resistance evaluation and fungicidal management (Sharma et al., 1998; Pannu et al., 2009).  The disease causes upto 40% losses in the yield. Most of the aromatic rice varieties are susceptible to the disease. Therefore, it can decrease the production of basmati rice to 28.44 lakhs tones worth for 6179.84 crores loss in export per year, which signifies its importance in near future. ICAR -Indian Agricultural Research Institute

4. How does the disease look like?  The typical symptoms of bakanae are slender, chlorotic and abnormally elongated primary leaves.  However, crown rot is also seen, resulting in stunted rice plants.  In crops reaching maturity infected plants show tall lanky tillers bearing pale green flag leaves  Infected plants usually have small numbers of tillers and plants die in few weeks.  Occasionally infected plants survive until maturity but bear empty panicles. ICAR -Indian Agricultural Research Institute Different symptoms produced by F. fujikuroi in rice seedlings ; A: elongation; B: rotting; C:elongated and rotted plants

5. Research gaps and objectives  An understanding of the pathogen’s population structure, its aggressiveness, and its genetic diversity is required for the development and implementation of effective management strategies. However, no studies have characterized the Indian population of F. fujikuroi.  The objectives of this study were to determine the morphological, pathological, and molecular diversity, as well as the mating types of the F. fujikuroi population isolated from symptomatic bakanae-diseased rice plants in India. ICAR -Indian Agricultural Research Institute

6. Geographical distribution of Fusarium fujikuroi isolates of this study ICAR -Indian Agricultural Research Institute

7. Bakanae disease in rice variety Pusa Basmati -1121 ICAR -Indian Agricultural Research Institute

8. StatesDistricts % Disease incidence Variety grown HaryanaKarnal2CSR 30 PunjabFatehgarh101401 Uttar Pradesh Aligarh151401 Buladshaher72511 Gautam Budha Nagar 31509 UttarakhandHaridwar02 Dehradoo n Basmati Udham Singh Nagar 02Pakistani Basmati Incidence of bakanae disease in different rice varieties Bakanae disease in different rice varieties ICAR -Indian Agricultural Research Institute

9. Survey for Bakanae disease of rice ICAR -Indian Agricultural Research Institute

10. Methodology Collection of diseased samples Diseased samples were collected from farmer’s fields from different states of India. No specific permissions were required for the collection, farmers happily permitted as they were also feeling concern about the disease. Fungal isolates and maintenance A total of 63 different Fusarium infected rice samples were collected from the farmers field of different Basmati growing states of India (Punjab, Haryana, Uttarakhand, Uttar Pradesh and Bihar). ICAR -Indian Agricultural Research Institute

11. Cultural and morphological variability All the 63 isolates of F. fujikuroi were grown on potato dextrose agar (PDA) and carnation leaf agar (CLA) medium. Pathogenicity test ICAR -Indian Agricultural Research Institute Seed inoculation in variety Pusa Basmati 1509

12. Molecular characterizations Genomic DNA extraction Universal Rice Primers and Polymerase chain reaction Mating type evaluation ICAR -Indian Agricultural Research Institute

13. Morphological characterization of Fusarium fujikuroi isolates Isolates classified based on radial growth at 5 days after inoculation >6 cm: fast growing 4-5.9 cm: Moderate growing 3-3.9 cm: slow growing Isolates classified based on pigment color ICAR -Indian Agricultural Research Institute Isolates of Fusarium fujikuroi showing different colours: a: Yellowish white; b: pink and c: purple

14. Characterization of F. fujikuroi isolates for their virulence ICAR -Indian Agricultural Research Institute Virulence Categories Isolates name Percentage (%) Moderately virulent (2-25 %) F204, F228, F341, F273, F301a, F302, F237a, F284, F308, F309, F249, F252, F252a, F253, F282, F299, F347 26.98 Highly virulent (26-50 %) F206a, F216a, F218a, F220, F229, F267, F278a, F301, F210a, F232, F303, F320, F328, F343, F255a, F350, F352 26.98 Most virulent (51-100 %) F203, F206, F219, F224, F231, F234, F259, F268, F269, F276, F338, F304, F306, F314, F338a, F343a, F210, F284a, F310, F250, F256, F319, F322, F327, F337, F337a, F255, F348, F351 46.04

15. Details of Universal Rice Primers (URP) used to amplify DNA of Fusarium fujikuroi isolates PrimersPrimer sequenceTotal no. of bands Polymorphic bands Monomorphic bands Polymorphism (%) URP 1FATCCAAGGTCCGAGACAACC86275% URP 9FATGTGTGCGATCAGTTGCTG1211191.67% URP 32FTACACGTCTCGATCTACAGG14 0100% URP 6RGGCAAGCTGGTGGGAGGTAC15 0100% URP 13RTACATCGCAAGTGACACAGG990100% URP 17RAATGTGGGCAAGCTGGTGGT16 0100% Total7471394.44% ICAR -Indian Agricultural Research Institute Genomic DNA amplification of all 63 isolates of F. fujikuroi produced 74 bands, of which 71 showed polymorphism

16. Diversity analysis of Fusarium fujikuroi isolates DNA finger print profile of Fusarium fujikuroi isolates obtained with primer URP-17R ICAR -Indian Agricultural Research Institute M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 M Fig. from left to right- M:molecular marker 1kb; Fusarium isolate code 1 to 63 203,204,206,206a,218a,219,220,224,228,229,231,234,259,267,268,269, 341, 273, 276,278a,338, 301,301a, 302,303,304,306, 314, 237a,338a,343a, 210,210a,232,284,284a,309,310,308,249,250,252,252a,253,256,282, 319,320,322,327, 328, 337,337a,343,255,255a,299,347,348,350,351,352 DNA finger print profile of Fusarium fujikuroi isolates obtained with primer URP-32F The maximum number of bands (16) were obtained using the URP 17R primer

17. Diversity analysis of Fusarium fujikuroi isolates III IV I a b c II Dendrogram obtained after combined analysis of Fusarium fujikuroi isolates collected from different states of India Plot of genetic distances and geographical distances derived using the Mantel test in F. fujikuroi isolates from six states of India (geographical distances means distances based on longitudinal-latitudinal coordinates) ICAR -Indian Agricultural Research Institute Subcluster a comprised 27 isolates from Punjab Isolates collected within the geographical distances of 300–600km were more variable compared to isolates collected from larger distances

18. Amplification of MAT-1 and MAT-2 locus of the Fusarium fujikuroi isolates collected from different states of India (Isolates 1-17, 19-24, 26-32, 55-56 collected from Punjab; 25, 33-39: Uttar Pradesh; 18, 57, 58: Uttarakhand; 40-54: Haryana; 59-62: Bihar and 63: Jammu and Kashmir) Mating type distribution in Indian population of Fusarium fujikuroi inciting bakanae disease of rice Perithecia of Fusarium fujikuroi GMAT 1a- 5’ GTTCATCAAAGGGCAAGCG 3’ GMAT 2b- 5’ TAAGCGCCCTCTTAACGCCTTC 3’ GMAT 2C- 5’ AGCGTCATTATTCGATCAAG 3’ GMAT 2d- 5’ CTACGTTGAGAGCTGTACAG 3’ Among the 63 isolates evaluated 18 (28.57%) were identified as MAT-1 and 45 (71.42%) as MAT-2. Distribution of MAT-2 population was highest in Haryana (86.67%), followed by Punjab (71.0%). Effective population no. N e(mt) for mating type was 89% of the total population. Study on female sterility needs to be conducted. 800 bp MAT- 2 300bp MAT- 1 ICAR -Indian Agricultural Research Institute

19. Conclusions  The present study generated significant information on morphological, pathogenic and molecular variability in Indian population of F. fujikuroi, which could be utilized for the development of resistant varieties of rice.  Further, study also confirms the presence of both the mating types of F. fujikuroi in India, therefore, existence of sexual reproduction in this species could not be avoided. ICAR -Indian Agricultural Research Institute

20. Acknowledgements Director, IARI Joint Director Research, IARI Dean & Joint Director Education, IARI Co-ordinator, School of Crop Protection Head of the Division Mr. Dheeraj Kumar Sapna, Kirti ICAR -Indian Agricultural Research Institute