1. Finnish Genome Center Monday, 16 November 20151 Genotyping & Haplotyping

2. Finnish Genome Center Genotyping Analysis of DNA-sequence variation Human DNA sequence is 99.9% identical between individuals →3000 000 varying nucleotides Polymorphism: normal variation between individuals (frequency> 1% of population) Genetic variation May cause or predispose to inheritable diseases Determines e.g. individual drug response Used as markers to identify disease genes

3. Finnish Genome Center Important terms Allele Alternative form of a gene or DNA sequence at a specific chromosomal location (locus) at each locus an individual possesses two alleles, one inherited from each parent Genotype genetic constitution of an individual, combination of alleles Genetic marker Polymorphisms that are highly variable between individuals: Microsatellites and single nucleotide polymorphisms (SNPs) Marker may be inherited together with the disease predisposing gene because of linkage disequilibrium (LD)

4. Finnish Genome Center Linkage disequilibrium, LD Alleles are in LD, if they are inherited together more often than could be expected based on allele frequencies Two loci are inherited together, because recombination during meiosis separates them only seldom

5. Finnish Genome Center Microsatellite markers Di-, tri-, tetranucleotide repeats GAACGTACTCACACACACACACATTTGAC TTCGATGATAGATAGATAGATAGATACGT the number of repeats varies (→ 30) highly polymorphic distributed evenly throughout the genome easy to detect by PCR

6. Finnish Genome Center SNP markers Single Nucleotide Polymorphisms (SNPs) GTGGACGTGCTT[G/C]TCGATTTACCTAG The most simple and common type of polymorphism Highly abundant; every 1000 bp along human genome Most SNPs do not affect on cell function some SNPs could predispose people to disease or influence the individual’s response to a drug

7. Finnish Genome Center SNP genotyping techniques over 100 different approaches Ideal SNP genotyping platform: high-throughput capacity simple assay design robust affordable price automated genotype calling accurate and reliable results

8. Finnish Genome Center...SNP genotyping techniques PCR discrimination between alleles: allele-specific hybridization allele-specific primer extension allele-specific oligonucleotide ligation allele-specific enzymatic cleavage detection of the allelic discrimination: light emitted by the products mass change in the electrical property

9. Finnish Genome Center High-throughput genotyping; Finnish Genome Center as an example Independent department of University of Helsinki since 1998 National core facility for the genetic research of multifactorial diseases Provides collaboration and genotyping service to scientist and research groups in Finland, also abroad

10. Finnish Genome Center Goals of the Finnish Genome Center help designing genetic studies perform high-throughput genotyping perform data analysis training of scientists adopt and develop new strategies & technologies

11. Finnish Genome Center Research strategies Genome-wide scan ~400 microsatellite markers at 10 cM interval Family-data Fine mapping Candidate regions identified by a genome scan Project specific microsatellite or SNP markers SNP genotyping Candidate genes Fine mapping Sequenom: MassArray MALDI-TOF

12. Finnish Genome Center Setting up PCR-reactions

13. Finnish Genome Center Electrophoresis run for microsatellites

14. Finnish Genome Center Microsatellite data MarkerWell IDSampleIDAllele1Allele2Size1Size2 D7S513H01OA.116162628190.93195.02 D7S517C07DYS.50202626262.19262.19 D7S640B02DYS.38192629133.41139.41 D7S640G12OA.15282629133.59139.46 D7S669E05OA.116152629190.37196.61 D8S258B06DYS.50012627159.38161.38 D8S260C02DYS.39312626215.57215.57 D8S264H01OA.116162626158.86158.86

15. Finnish Genome Center SNP genotyping with MassARRAY (MALDI-TOF) Primer extension reactions designed to generate different sized products Analysis by mass spectrometry C/T G/A GGACCTGGAGCCCCCACC GGACCTGGAGCCCCCACCC GGACCTGGAGCCCCCACCTC Extendable primer C analyte T analyte 5430.5 5703.7 5976,9.9 Mass in Daltons G/A ddCTP dTTP dATP dGTP

16. Finnish Genome Center Mass spectrometry multiplexing

17. Finnish Genome Center SNP data ASSAY_IDCHIP_IDWELL_IDSAMPLE_IDGENOTYPEDESCRIPTION rs105631A01IDE.26738ACA.Conservative rs105631A02IDE.35271AA.Conservative rs35271B05IDE.68466TGA.Conservative rs67792A01IDE.35357GB.Moderate rs1356272B02IDE.35328CA.Conservative rs427783C04IDE.87378ACA.Conservative rs7555554D12IDE.83257AA.Conservative rs451675E10IDE.54727AA.Conservative rs478906F01IDE.25335ACA.Conservative

18. Finnish Genome Center SNP genotyping workflow at FGC

19. Finnish Genome Center Haplotype Multiple loci in the same chromosome that are inherited together Usually a string of SNPs that are linked alleles locus haplotypes

20. Finnish Genome Center Haplotype construction No good molecular methods available to identify haplotypes Genotypes→Haplotypes, two alternatives SNP1 AT A T A T SNP2 GC G C C G → Computational methods to create haplotypes from genotype data

21. Finnish Genome Center...Haplotype construction Family-based haplotype construction Linkage analysis softwares: Simwalk, Merlin, Genehunter, Allegro... Population-based haplotype construction Not as reliable as family-based EM-algorithm (expectation maximization algorithm), described in http://www- gene.cimr.cam.ac.uk/clayton/software/ SnpHap PHASE

22. Finnish Genome Center Haplotype blocks Low recombination rate in the region Strong LD Low haplotype diversity Small number of SNPs in the block are enough to identify common haplotypes; tag SNPs

23. Finnish Genome Center recombination x chromosomes Formation of haplotype blocks meiosis 111111 222222 221221 112112

24. Finnish Genome Center Few generationsHundreds of generations 221221 231231

25. Finnish Genome Center Average block size African populations: 11 kb Non-african populations: 22 kb 60%-80% of the genome is in the blocks of > 10 kb 1-150 kb

26. Finnish Genome Center Block frequencies Typically, only 3-5 common haplotypes account for >90% of the observed haplotypes

27. Finnish Genome Center Benefits of haplotypes instead of individual SNPs Information content is higher Gene function may depend on more than one SNP Smaller number of required markers The amount of wrong positive association is reduced Replacing of missing genotypes by computational methods Elimination of genotyping errors Challenges: Haplotypes are difficult to define directly in the lab; computational methods Defining of block boarders is ambiguous; several different algorithms

28. Finnish Genome Center The HapMap project International collaboration to create a map of human genetic variation The map is based on common haplotype patterns Includes information on SNPs (location, frequency, sequence) Haplotype block structure Distribution of haplotypes in different populations

29. Finnish Genome Center