1. Now on Bio308 Translation: Converting the blueprint into a working model 36” 72’ Grade P red oak, inlay mahaog

2. Previously on Bio308 Genes: definition and parts Nucleic Acids: DNA: basic parts, the bonds that link bases into strands the bonds that make strands into double helix RNA: basic parts and bonds differences between it and DNA types of RNA in the cell Transcription: Copying genetic information from DNA to mRNA what are the steps? (transcription and processing) where does it occur? why is it necessary?

3. Nucleotides to proteins: Step II Are cytosolic and integral membrane proteins transcribed the same way? Are they translated the same way? From nucleotides to amino acids---How? Three basic steps:InitiationElongationTermination Fig 4-26

4. Two adaptors used: tRNA and amino acyl tRNA-synthetases Codons, Anticodons, and Wobble ‘Charging’ of tRNA Basepairing with a tRNA Fig4-26 Using Inosine w/ A, U, or C Fig 4-28

5. That Degenerate Genetic code # codons > # tRNAs > # aminoacids How did they figure out the genetic code? Strings of identical nucleotides Nirenberg CCAGAGCAGACUGCUUAGCUUCAUCCCACGAACGGGAG P E Q T A STOP L H P T N G ? Q S R L L S F I P R T G R A D C L A S S H E R E

6. Initiation Players? How does the complex know where to start translating? In Bacteria? In eukaryotes? 3’ mRNA 5’ AAAAAAAA Initiation factors IFs Small subunit of ribosome Initiator tRNA Met Once initiation complex forms large subunit of ribosome is recruited

7. Elongation Players? mRNA Aminoacyl- tRNAs Elongation factors Ribosome Requires GTP hydrolysis Results in peptide bond formation Chain grows from N to C P site A site E site CBI 6.4 Translation

8. Termination Players? mRNA Termination factors Ribosome Fig 4-40 How does it work? Why does the chain end?

9. The Protein What happens to the protein? Folding Sorting What happens to the mRNA, the ribosomes and the tRNA? Reuse Polysomes

10. Translation, Bipolar Disorder, and …… What does this have to do with bipolar disorder? Synthesized in cytosol sorted/packaged into vesicles for use Tale of 2 proteins--- a stretched metaphor Many neurotransmitters are amino acids, amino acid derivatives (like dopamine), or short peptides How does the neurotransmitter packaging occur? Transporters found in cellular membranes Nobel Prize for Medicine 2000: Dopamine as a neurotransmitter and its role in brain dysfunctions (Dopamine is the catecholamine implicated in bipolar disorder)

11. Synaptic vesicles What are they? Vesicles are membrane spheres Neurotransmitters are polar How do they get in?