1. Chapter 13 Regulation of Gene Activity

2. Humans and nemotodes have about the same number of genes roughly 20,500 So how can a complex organism produce the proteins they require? By regulation of pre-mRNA splicing to produce many proteins from a single gene In 1961, Jocob and Monod showed that the bacteria Escherichia coli could regulate the expression of genes They received the Nobel prize for the “operon model” to express gene regulation in prokaryotes

3. Operon includes: Promoter which is a short sequence of DNA where RNA polymerase first attaches to begin transcription Operator which is a short portion of DNA where an active repressor binds When active repressor binds to operator, RNA polymerase cannot attach to promoter and no transcription Structural genes are one to several genes coding for primary structure of enzymes in metabolic pathway transcribed as a unit Regulator gene, usually located outside operon and controlled by own promoter, codes for a repressor

4. that controls whether the operator is active or not -Some operons in E. coli are usually in “on” rather than “off” condition -Trp operon, the regulator codes a repressor that ordinarily is unable to attach to operator -RNA polymerase is able to bind to promoter and structural genes are expressed -Then five enzymes promote anabolic pathway for synthesis of amino acid tryptophan -If tryptophan is present, it binds to the repressor, changes its shape and binds to operon Structural genes are not expressed

5. Entire unit is called a repressor operon Tryptophan is the corepressor Repressible operons are usually involved in anobolic pathways

6. Fig. 13.1 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. regulator genepromoteroperatorstructural genes DNA RNA polymerase RNA polymerase cannot bind to promoter. mRNA enzymes inactive repressor a. Tryptophan absent. Enzymes needed to synthesize tryptophan are produced. DNA inactive repressor b. Tryptophan present. Presence of tryptophan prevents production of enzymes used to synthesize tryptophan. tryptophan active repressor 5 3

7. Bacteria metabolism is efficient If a protein or enzyme is not needed, genes to make them are inactive If lactose is not present, enzymes for lactose catabolism are not active If E coli are denied glucose and given lactose, it immediately makes the three enzymes needed to metabolize lactose The three structural genes needed are adjacent to one another and under control of a single promoter and operon Lac operator repression usually binds to operator and prevents transcription

8. Lactose binds to repressor, changes its shape that prevents its binding to promoter RNA polymerase binds to promoter and carries out transcription of enzymes for lactose metabolism Presence of lactose brings about expression of genes and is called inducer Entire unit is called inducible operon Inducible operons are usually necessary for catabolic pathways

9. Fig. 13.2 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. regulator genepromoteroperatorstructural genes DNA RNA polymerase cannot bind to promoter. RNA polymerase can bind to promoter. active repressor mRNA enzymes active repressor inactive repressor b. Lactose present. Enzymes needed to take up and use lactose are produced only when lactose is present. a. Lactose absent. Enzymes needed to take up and use lactose are not produced. lactose DNA 5 3

10. E coli prefers using glucose A molecule called cyclic AMP (cAMP) accumulates when glucose is absent cAMP binds to a molecule called catabolite activator protein (CAP) and the complex attaches to site next to lac promoter This bends DNA exposing the promoter to RNA polymerase

11. Page 236 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. adenine OH CH 2 cyclic AMP (cAMP) O P 5 3

12. Fig. 13.3 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DNA inactive CAP active CAP a. Lactose present, glucose absent (cAMP level high) b. Lactose present, glucose present (cAMP level low) DNA cAMP promoter CAP binding site RNA polymerase binds fully with promoter. RNA polymerase does not bind fully with promoter. promoteroperator CAP binding site

13. Each cell in multicellular eukaryote, has a copy of all genes Different genes are actively expressed in different cells Types of control in eukaryotic cells: 1) Chromatin structure- Chromatin packing is used to keep genes turned off by preventing access to RNA polymerase In nucleus, loosely condensed chromatin is available for transcription Part of epigenetic inheritance, the transcription of genetic information outside coding sequence of a gene

14. 2) Transcriptional control is the degree to which a gene is transcribed into mRNA determines amount of gene product Transcription factors may promote or repress transcription 3) Posttranscriptional control involves mRNA processing and how fast mRNA leaves the nucleus Can determine type of protein product made and amount of gene product made in a given time 4) Translational control occurs in cytoplasm and affects when translation begins and how long it continues

15. Any influence on the persistence of 5’ cap and 3’ poly-A tail affect length of translation Excised introns are involved in regulatory system and affect life span of mRNA 5) Posttranslational control occurs in cytoplasm after protein synthesis Only functional protein is an active gene product

16. Fig. 13.4 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. functional protein plasma membrane polypeptide chain Posttranslational control Posttranscriptional control Transcriptional control Translational control nuclear pore mRNA pre- mRNA intronexon histones nuclear envelope Chromatin structure 3 3 5 5

17. Highly condensed heterochromatin is inaccessible to RNA polymerase It appears as darkly stained portions within nucleus in electron micrographs Example of heterochromatin is the Barr body in mammalian females It is an inactive X chromosome that does not produce gene products In females one X chromosome transcribes genes and the other becomes a Barr body Which X is inactive depends on which X chromosome that cell received

18. One X comes from father and the other from the mother Conditions in human females include: ocular albinism, Duchanne muscular distrophy, X-linked hereditory absence of sweat glands

19. Fig. 13.6 Coats of tortoiseshell cats have patches of orange and black. One X chromosome is inactivated in each cell. Which one is by chance. Females have two X chromosomes. active X chromosome inactive X active X chromosome allele for orange color allele for black color cell division Barr bodies © Chanan Photo 2004 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

20. Term euchromatin is used for the more loosely packed active chromatin In herterochromatin, the histone tails tend to bear methyl groups (-CH3) In euchromatins, the histone tails tend to be acetylated and have attached acetyl groups (-COCH3) When euchromatin is transcribed, chromatin remodeling complex pushes aside the histone portion of nucleosome so access to DNA is not barred Also affects gene expression by adding acetyl or methyl groups to histone tails Epigenetic inheritance concerns the pattern of inheritance that does not depend on only the genes

21. If a histone is methylated, the DNA may also be methylated Genomic imprinting occurs when either the mother’s or father’s allele is methylated during gamete formation If inherited, the gene is not expressed Transcriptional control is the most critical of all controls No operons like those in prokaryotic cells have been found in eukaryotes Every cell contains transcriptional factors, proteins that help regulate transcription

22. In eukaryotes, transcription activators are DNA binding proteins that speed transcription They bind to a region of DNA called enhancer that can be far away from promoter A hairpin loop in the DNA brings the transcription activators attached to enhancers into contact with transcriptional factor complex Transcription factors, activators,and repressors are always present in nucleus, but have to be activated before they bind to DNA

23. Fig. 13.7 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. promoter DNA enhancer transcription activator mediator proteins mRNA transcription RNA polymerase transcription factor complex gene

24. During pre-mRNA splicing, introns (noncoding regions) are excised, and exons (expressed regions) are joined together to form mRNA Sometimes an exon is skipped or an intron is included Results in mature mRNA that has an altered sequence, and protein encoded differs

25. Fig. 13.8 intron cap protein product 1 mRNA RNAsplicing poly-A tail exonintron protein product 2 RNAsplicing exon a.b. cap ABCDE ABCDE ABC C DE ADEB 3 5 5 pre-mRNA mRNA pre-mRNApoly-A tail 3 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

26. Translation control begins when processed mRNA reaches cytoplasm and before there is a protein product Includes presence or absence of 5’ cap and length of poly-A tail at 3’ end Micro RNAs (miRNAs) can regulate translation by causing the destruction of mRNAs before they can be translated Much like a dimmer switch on a light, miRNAs can fine-tune the expression of genes

27. Fig. 13.9 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. pre-mRNA MicroRNA is cut from a pre-mRNA and binds with proteins to form RISC. Complementary base pairing between RNAs allows RISC to bind to mRNA. Translation is inhibited. The mRNA is degraded. mRNA RISC (RNA-induced silencing complex) microRNA (miRNA) proteins or RISC 5 3 3 5 5 3

28. A gene mutation is a permanent change in the sequence of bases in DNA Can range from no effect to complete inactivation Germ-line mutations occur in sex cells and can be passed to subsequent generations Somatic mutations occur in body cells and affect only a small number of cells in a tissue Somatic mutations are not passed on to future generations, but can lead to cancer Spontaneous mutations are associated with any number of normal processes The movement of transposons from one chromosomal

29. location to another can disrupt a gene and lead to an abnormal product A base in DNA may undergo a chemical change that leads to a miss pairing during replication These mutations are rare because DNA polymerase proofreads the new strand against the old strand, detects most mismatched nucleotides, and usually replaces them with correct nucleotides Induced mutations are caused by mutagens, environmental factors that can alter base composition of DNA Includes radiation and organic chemicals

30. Many mutations are also carcinogens (cancer-causing) Chemical mutagens are present in some food we eat and many industrial chemicals Tobacco smoke contains a number of carcinogenic organic chemicals One-third of all cancer deaths can be attributed to smoking Lung cancer is most frequent lethal cancer in the United States Ames test is used for mutagenicity of a chemical to be carcinogenic A histidine-requiring strain of bacteria is exposed to

31. the chemical If the chemical is mutagenic, bacteria can grow without histidine

32. Fig. 13.10 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. bacterial strain (requires histidine) Control Mutation did not occurMutation occurred Suspected chemical mutagen bacterial strain (requires histidine) Plate onto petri plates that lack histidine. Incubate overnight bacterial growth

33. Point mutations involve a change in a single DNA nucleotide with a possible change in a specific amino acid Frameshift mutations occur most often because one or more nucleotides are either inserted or deleted from DNA May form a completely new sequence of codons and nonfunctioning protein A single nonfunctioning protein can have a dramatic effect on the phenotype, because enzymes are often part of metabolic pathways

34. Page 244 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. (phenylalanine)(tyrosine)(melanin) AEAEA CBEBEB

35. Fig. 13.12 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. b. Normal red blood cell a. c. Sickled red blood cell No mutation ValHisLeuThrProGlu (normal protein) His (abnormal protein) GluVal (incomplete protein) GluStop CTCCTCTGGAGTCACGTGGAG CTCCTCTGGAGTCACGTGAG ValHisLeuThrProGlu CTCCACTGGAGTCACGTGGAG ValHisLeuThrProGlu CTCCATGGAGTCACGTGGAGT ValHisLeuThrProStop A b, c: © Stan Flegler/Visuals Unlimited. Val 3 5

36. The development of cancer involves a series of accumulating mutations that can be different for each type of cancer The cell cycle occurs inappropriately when proto- oncogenes become oncogenes and tumor suppressor genes are no longer effective