Download presentation
1
A Primer for Future Jurors (or Criminals)
DNA Fingerprinting A Primer for Future Jurors (or Criminals) Copyright 2007 John Sayles
2
Genetic Background Only about 10% of our DNA is found in genes
Other 90% is “junk” DNA DNA that doesn’t code for protein production This is the stuff that makes us unique Copyright 2007 John Sayles
3
Uses of DNA Fingerprinting
Forensic cases -- matching suspect with evidence Paternity testing -- identifying father Historical investigations Missing persons investigations Mass disasters – matching tissue to known DNA to identify victims Military DNA “dog tag” Convicted felon DNA databases (CODIS) Copyright 2007 John Sayles
4
Sources of DNA Evidence (anything containing cells)
Blood Semen Saliva Urine Hair Teeth Bone Tissue (skin, muscle) Copyright 2007 John Sayles
5
RFLP Profiling Restriction Fragment Length Polymorphisms
Older technology, but still used Requires larger sample Used in OJ, Clinton cases Copyright 2007 John Sayles
6
RFLP (“rif-lip”) Restriction Enzymes are used to cut DNA at specific places RE’s recognize certain base (ATGC) sequences and snip at that location The fragments are then separated using Electrophoresis Light chunks move faster The fragments are exposed to radioactive probes that attach to repeating base sequences only a small % of RFLP’s are “lit up” Copyright 2007 John Sayles
7
Example of a RFLP A Restriction Enzyme: RFLP, w/probe:
Copyright 2007 John Sayles
8
Tandem Repeats The probed chunks of DNA contain tandem repeats
… GACTGACTGACTGACTGACT… = [GACT]5 The commonness of these tandem repeats is known a TR might occur in 10% of the population By looking for several known TR’s we can narrow likelihood of that combination Multiply % commonness of each TR Copyright 2007 John Sayles
9
An Electrophoresis Gel
Negatively charged DNA fragments are attracted to the positive charge on the right side of the gel. Shorter, lighter DNA fragments travel faster. Each sample contains many DNA fragments, but only the RFLP’s exposed tothe radioactive probes of repeating TR’s will show up as stripes on the exposed electrophoresis gel. Copyright 2007 John Sayles
10
Probability Analogy Blood type O was found at a crime scene
The suspect is type O, but so is 50% of the population Suspect is not excluded, but not proven guilty either Bruno Magli shoe prints were found at the crime scene The suspect owns Bruno Magli’s, like 2% of the population The Bruno Magli’s are size 12’s The suspect is size 12, like 10% of the population The % of the population with all three is 50% x 2% x 10% = 0.1% of population = 1 of 1,000 Copyright 2007 John Sayles
11
Calculating TR possible matches in population
3 different TR identified in sample X = 10% in population Y = 5% in population Z = 25% in population To determine the chance of someone else in population that has this combination of TR just change % into decimal then multiply all together
12
Calculating TR possible matches in population
X = 10% = .10 Y = 5% = .05 Z = 25% = .25 (.10)(.05)(.25) = = .125% chance Or 1 person in 1000 would match TR
13
Gel Used in Court In a rape case, DNA was tested from:
semen removed from the victim (EVIDENCE #2); semen left on the victim's clothing (EVIDENCE #1); the DNA of the victim herself (VICTIM) to be sure that the DNA didn't come from her cells; DNA from two suspects (SUSPECT #1, SUSPECT #2); a set of DNA fragments of known and decreasing length (MARKER). They provide a built-in ruler for measuring the exact distance that each fragment travels. the cells of a previously-tested person to be sure the probes are performing properly (CONTROL). Who’s guilty? Who’s not guilty? (ie, who’s excluded?) Who’s not excluded? What more would you need to convict suspect 1? Copyright 2007 John Sayles
14
RFLP Review Restriction Enzymes are used to cut DNA at specific places
RE’s recognize certain base (ATGC) sequences and snip at that location The fragments are then raced using Electrophoresis Light chunks move faster The fragments are exposed to radioactive probes that attach to repeating base sequences Copyright 2007 John Sayles
15
The Clinton Case A sample from the “blue dress” was compared to a DNA sample collected from President Clinton 7 different RFLP’s were examined no expense was spared The odds of that combination of RFLP’s was 1 in 7.8 trillion ie, 1 person on 1,000 Earths had that combination. (see text, page 322) Copyright 2007 John Sayles
16
7 RFLP “markers” examined
The Restriction Enzyme used “K” = Known sample 1 in 7.87 trillion Caucasians has this combination of markers “Q” = Questioned sample #3243 is the Blue Dress Document from Copyright 2007 John Sayles
17
The Simpson Case The Unlucky Sock Found in OJ’s house
Who’s blood is it? Who’s blood isn’t it? Would you convict on this alone? How much more evidence would you need? DNA Evidence in the O. J. Simpson Trial Copyright 2007 John Sayles
18
PCR DNA Analysis Polymerase Chain Reaction
Uses DNA polymerase enzyme to amplify DNA in small samples Can start with a nanogram sample Can double DNA every two minutes Billion-fold increase in 1 hour Fully automated, inexpensive Copyright 2007 John Sayles
19
STR DNA Analysis Short Tandem Repeats
Same idea as RFLP analysis, but with shorter DNA segments Better than RFLP works with much smaller sample less susceptible to damage or decomposition effects FBI’s CODIS use 13 STR loci as basis for its analysis technique Copyright 2007 John Sayles
Similar presentations
© 2025 SlidePlayer.com Inc.
All rights reserved.