Download presentation
Presentation is loading. Please wait.
Published byLee Stevens Modified over 9 years ago
1
Human Identity Testing Purpose: Match a person to a DNA sample. Examples: Paternity Test Genetic History Historical (Thomas Jefferson, Sally Hemings) Genealogical Forensic Missing Persons Identifying body parts
2
Forensic DNA Source: Any biological material containing cells Examples: Blood Hair (must have root) Bone / teeth Saliva Urine Semen Vaginal secretions Futuristic: discarded epidermal cells
3
CODIS (Combined DNA Index System) Factoids: 1990: pilot launched by FBI 1994: DNA Identification Act passed (authorized FBI to implement a national forensic data base) 1998: became operational 2000: added missing persons Purpose: Allow participating laboratories to exchange and compare profiles at a national level in electronic form.
4
CSF1PO D5S818 D21S11 TH01 TPOX D13S317 D7S820 D16S539D18S51 D8S1179 D3S1358 FGA VWA AMEL CODIS: 13 STR Loci and AMEL
5
STR (Short Tandem Repeat) TCATTCATTCATTCATTCATTCAT 123456 TCATTCATTCATTCATTCATTCATTCAT 1234567 TCATTCATTCATTCATTCATTCATTCATTCAT 12345678 TH01: TCAT repeat in the first intron of the tyrosine hydroxylase gene
6
STR Allele Frequencies 0 5 10 15 20 25 30 35 40 45 67899.310 Caucasians (N=427) Blacks (N=414) Hispanics (N=414) TH01 Marker * Proc. Int. Sym. Hum. ID (Promega) 1997, p. 34 Number of repeats Frequency
7
Reference 67899.3 10 Moe: 7/9 Larry: 9.3/9.3 Curly: 6/9 Genotyping at the TH01 Locus:
8
Moe: 7/9 Larry: 9.3/9.3 Curly: 6/9 Crime Scene DNA
9
AMEL (amelogenin locus) quick, inexpensive sex determination AMEL gene on X chromosome has 6 fewer base pairs than the gene on the Y chromosome XX give one “short” peak XY give two peaks, one “short” and one “long”
10
amelogenin D19 D3 D8 TH01 VWA D21 FGA D16 D18D2 amelogenin D19 D3 D8 TH01 VWA D21 FGA D16 D18 D2 Human Identity Testing with Multiplex STRs Simultaneous Analysis of 10 STRs and Gender ID AmpFlSTR ® SGM Plus™ kit first person second person
Similar presentations
© 2025 SlidePlayer.com Inc.
All rights reserved.