1. Structure & concept of gene, One gene one enzyme hypothesis, Genetic Code PROTEIN SYNTHESIS, Regulation of gene expression Dr. Madhumita Bhattacharjee Assiatant Professor Botany Deptt. P.G.G.C.G. -11,Chandigarh

2. Definitions of the gene The gene is the unit of genetic information that controls a specific aspect of the phenotype. The gene is the unit of genetic information that specifies the synthesis of one polypeptide.

3. 1942: George Beadle and Edward Tatum Studied relationships between genes and enzymes in the haploid fungus Neurospora crassa (orange bread mold). Discovered that genes act by regulating definite chemical events. One Gene-One Enzyme Hypothesis Each gene controls synthesis/activity of a single enzyme. “one gene-one polypeptide” 1958: George Beadle (Cal Tech) & Edward Tatum (Rockefeller Institute)

4. Beadle and Tatum (1942)--One Gene, One Enzyme Bread mold Neurospora can normally grow on minimal media, because it can synthesize most essential metabolites. If this biosynthesis is under genetic control, then mutants in those genes would require additional metabolites in their media. This was tested by irradiating Neurospora spores and screening the cells they produced for additional nutritional requirements (auxotrophs).

5. Beadle and Tatum proposed: “One Gene-One Enzyme Hypothesis” However, it quickly became apparent that… 1. 1.More than one gene can control each step in a pathway (enzymes can be composed of two or more polypeptide chains, each coded by a separate gene). 2. 2.Many biochemical pathways are branched. “One Gene-One Enzyme Hypothesis” “One Gene-One Polypeptide Hypothesis”

6. Modern Concept of Gene Until 1940, the gene was considered as the basic unit of genetic information as defined by three criteria. - Cistron:The unit of function, controlling the inheritance of one “character” or phenotypic attribute. –Recon : The unit of recombination –Muton:The unit of mutation.

7. 7 Genetic code: Def. Genetic code is the nucleotide base sequence on DNA ( and subsequently on mRNA by transcription) which will be translated into a sequence of amino acids of the protein to be synthesized. The code is composed of codons Codon is composed of 3 bases ( e.g. ACG or UAG). Each codon is translated into one amino acid. The 4 nucleotide bases (A,G,C and U) in mRNA are used to produce the three base codons. There are therefore, 64 codons code for the 20 amino acids, and since each codon code for only one amino acids this means that, there are more than one cone for the same amino acid. How to translate a codon (see table): This table or dictionary can be used to translate any codon sequence. Each triplet is read from 5′ → 3′ direction so the first base is 5′ base, followed by the middle base then the last base which is 3′ base.

8. 8 Examples: 5′- A UG- 3′ codes for methionine 5′- UCU- 3′ codes for serine 5′ - CCA- 3′ codes for proline Termination (stop or nonsense) codons: Three of the 64 codons; UAA, UAG, UGA do not code for any amino acid. They are termination codes which when one of them appear in mRNA sequence, it indicates finishing of protein synthesis. Characters of the genetic code: 1- Specificity: the genetic code is specific, that is a specific codon always code for the same amino acid. 2- Universality: the genetic code is universal, that is, the same codon is used in all living organisms, procaryotics and eucaryotics. 3- Degeneracy: the genetic code is degenerate i.e. although each codon corresponds to a single amino acid,one amino acid may have more than one codons. e.g arginine has 6 different codons

9. 9

10. 10 Gene mutation (altering the nucleotide sequence): 1- Point mutation: changing in a single nucleotide base on the mRNA can lead to any of the following 3 results: i- Silent mutation: i.e. the codon containg the changed base may code for the same amino acid. For example, in serine codon UCA, if A is changed to U giving the codon UCU, it still code for serine. See table. ii- Missense mutation: the codon containing the changed base may code for a different amino acid. For example, if the serine codon UCA is changed to be CCA ( U is replaced by C), it will code for proline not serine leading to insertion of incorrect amino acid into polypeptide chain. iii- Non sense mutation: the codon containing the changed base may become a termination codon. For example, serine codon UCA becomes UAA if C is changed to A. UAA is a stop codon leading to termination of translation at that point.

11. How your cell makes very important proteins proteinsThe production (synthesis) of proteins. 3 phases3 phases: 1.Transcription 2.RNA processing 3.Translation DNA  RNA  ProteinDNA  RNA  Protein

12. DNA  RNA  Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

13. Before making proteins, Your cell must first make RNA RNA(ribonucleic acid) DNA (deoxyribonucleic acid)How does RNA (ribonucleic acid) differ from DNA (deoxyribonucleic acid)?

14. RNADNA RNA differs from DNA RNAsugar ribose 1.RNA has a sugar ribose DNAsugar deoxyribose DNA has a sugar deoxyribose RNAuracil (U) 2.RNA contains uracil (U) DNAthymine (T) DNA has thymine (T) RNAsingle-stranded 3.RNA molecule is single-stranded DNAdouble-stranded DNA is double-stranded

16. 1. Transcription DNA strands RNAThen moves along one of the DNA strands and links RNA nucleotides together. Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

17. 1. Transcription OR RNA production RNA molecules are produced by copying part of DNA into a complementary sequence of RNA This process is started and controlled by an enzyme called RNA polymerase.

18. 1. Transcription DNApre-mRNA RNA Polymerase

19. Types of RNA Three types ofRNAThree types of RNA: A.messenger RNA (mRNA) B.transfer RNA (tRNA) C.ribosome RNA (rRNA) All types ofRNAproduced in the nucleus!All types of RNAproduced in the nucleus!

20. mRNA Carries instructions from DNA to the ribosome. Tells the ribosome what kind of protein to make

21. A. Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

22. rRNA Part of the structure of a ribosome Helps in protein production tRNA Bring right amino acid to make the right protein according to mRNA instructions

23. B. Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

24. RNA Processing Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

25. RNA Processing (Post Transcriptional Changes) IntronsexonsIntrons are pulled out and exons come together. mature RNA moleculenucleus cytoplasm.End product is a mature RNA molecule that leaves the nucleus & move to the cytoplasm.

26. RNA Splicing pre-RNA molecule intron exon Mature RNA molecule exon intron splicesome

27. Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

28. 3. Translation - making proteins Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

29. 3. Translation Three parts: initiation 1.initiation: start codon (AUG) elongation 2.elongation: termination 3.termination: stop codon (UAG)

30. 3. Translation P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

31. Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

32. mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

33. mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

34. mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

35. mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

36. mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

37. mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

38. mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

39. End Product primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein. amino acid peptide bondsA sequence of amino acid bonded together by peptide bonds. aa1 aa2 aa3 aa4 aa5 aa200 aa199

40. Regulation of Gene Expression

41. The control of gene expression Each cell in the human contains all the genetic material for the growth and development of a human Some of these genes will be need to be expressed all the time called Constitutive genes These are the genes that are involved in of vital biochemical processes such as respiration Other genes are not expressed all the time They are switched on an off at need called Non- constitutive genes

42. Operons An operon is a group of genes that are transcribed at the same time. They usually control an important biochemical process. Jacob, Monod & Lwoff

43. Inducible Genes - Operon Model Definition: Genes whose expression is turned on by the presence of some substance –Lactose induces expression of the lac genes Catabolic pathways

44. The lac Operon  The lac operon consists of three genes each involved in processing the sugar lactose  One of them is the gene for the enzyme β-galactosidase  This enzyme hydrolyses lactose into glucose and galactose

45. Lactose Operon Structural genes –lac z, lac y, & lac a –P-Promoter –Polycistronic mRNA R-Regulatory gene –Repressor Operator Inducer - lactose i Operon Regulatory Gene p oz y a DNA m-RNA  -Galactosidase Permease Transacetylase Protein

46. Lactose Operon Inducer -- lactose –Absence Active repressor No expression i p o z y a No lac mRNA Absence of lactose Active i p o z y a  -Galactosidase PermeaseTransacetylase Presence of lactose Inactive – –Presence Inactivation of repressor Expression

47. 1. When lactose is absent A repressor protein is continuously synthesised. It sits on a sequence of DNA just in front of the lac operon, the Operator site The repressor protein blocks the Promoter site where the RNA polymerase settles before it starts transcribing Regulator gene lac operon Operator site zya DNA I O Repressor protein RNA polymerase Blocked © 2007 Paul Billiet ODWSODWS

48. 2. When lactose is present A small amount of a sugar allolactose is formed within the bacterial cell. This fits onto the repressor protein at another active site (allosteric site) This causes the repressor protein to change its shape (a conformational change). It can no longer sit on the operator site. RNA polymerase can now reach its promoter site Promotor site zya DNA I O

49. Repressible Genes - Operon Model Definition: Genes whose expression is turned off by the presence of some substance (co-repressor) –Tryptophan represses the trp genes Co-repressor is typically the end product of the pathway

50. Tryptophan Operon Structural genes –trp E, trpD, trpC trpB & trpA –Common promoter Regulatory Gene –Apo-Repressor Inactive Operator Co-repressor –Tryptophan R Operon Regulatory Gene POEDC 5 Proteins B A L Inactive repressor (apo-repressor)

51. Tryptophan Operon Co-repressor -- tryptophan –Absence of tryptophan Gene expression R POEDC 5 Proteins B A L Inactive repressor (apo-repressor) Absence of Tryptophan R POEDC No trp mRNA B A L Presence of Tryptophan Inactive repressor (apo-repressor) Trp (co-repressor) – –Presence of tryptophan Activates repressor – –No gene expression Negative control