Download presentation
Presentation is loading. Please wait.
Published byStephany Harmon Modified over 8 years ago
1
1 Summary on similarity search or Why do we care about far homologies ? A protein from a new pathogenic bacteria. We have no idea what it does A protein from a model organism. We know what it does but we do not know who does the same in human? A protein related to a disease We have no idea what it does in relation to the disease
2
retinol-binding protein odorant-binding protein apolipoprotein D
3
RBP4 and obesity retinol-binding protein odorant-binding protein apolipoprotein D
4
Scoring matrices let you focus on the big (or small) picture retinol-binding protein retinol-binding protein PAM250 PAM30 Blosum45 Blosum80
5
PSI-BLAST generates scoring matrices more powerful than PAM or BLOSUM retinol-binding protein retinol-binding protein
6
Phylogenetic trees
7
7 Phylogeny is the inference of evolutionary relationships. Traditionally, phylogeny relied on the comparison of morphological features between organisms. Today, molecular sequence data are mainly used for phylogenetic analyses. One tree of life A sketch Darwin made soon after returning from his voyage on HMS Beagle (1831–36) showed his thinking about the diversification of species from a single stock (see Figure, overleaf). This branching, extended by the concept of common descent, Phylogeny in Greek =the origin of the tribe
8
8 Haeckel (1879)Pace (2001)
9
9 Molecular phylogeny uses trees to depict evolutionary relationships among organisms. These trees are based upon DNA and protein sequence data Human Chimpanzee Gorilla Orangutan Gorilla Chimpanzee Orangutan Human Molecular analysis: Chimpanzee is related more closely to human than the gorilla Pre-Molecular analysis: The great apes (chimpanzee, Gorilla & orangutan) Separate from the human
10
10 What can we learn from phylogenetics tree?
11
Was the extinct quagga more like a zebra or a horse? Determine the closest relatives of one organism in which we are interested
12
12 Which species are closest to Human? Human Chimpanzee Gorilla Orangut an Gorilla Chimpanzee Orangutan Human
13
13 Human Evolution Modern Man Neanderthals
14
14 Example Metagenomics A new field in genomics aims the study the genomes recovered from environmental samples. A powerful tool to access the wealthy biodiversity of native environmental samples Help to find the relationship between the species and identify new species
15
10 6 cells/ ml seawater 10 7 virus particles/ ml seawater >99% uncultivated microbes How can we discover new species in the ocean?
16
16 Relationships can be represented by Phylogenetic Tree or Dendrogram A B C D E F
17
17 Phylogenetic Tree Terminology Graph composed of nodes & branches Each branch connects two adjacent nodes A B C D E F R
18
18 Rooted tree Human Chimp Chicken Gorilla Human Chimp Chicken Gorilla Un-rooted tree Phylogenetic Tree Terminology
19
19 Rooted vs. unrooted trees 1 2 3 31 2
20
20 How can we build a tree with molecular data? -Trees based on DNA sequence (rRNA) -Trees based on Protein sequences
21
Basic algorithm for constructing a rooted tree Unweighted Pair Group Method using Arithmetic Averages (UPGMA) Assumption: Divergence of sequences is assumed to occur at a constant rate Distance to root is equal Sequence a ACGCGTTGGGCGATGGCAAC Sequence b ACGCGTTGGGCGACGGTAAT Sequence c ACGCATTGAATGATGATAAT Sequence d ACACATTGAGTGTGATAATA abcd
22
22 abcd a0875 b8039 c7308 d5980 Moving from Similarity to Distance Distance Table Sequence a ACGCGTTGGGCGATGGCAAC Sequence b ACACATTGAGTGTGATCAAC Sequence c ACACATTGAGTGAGGACAAC Sequence d ACGCGTTGGGCGACGGTAAT Distances * Sequences Dab = 8 Dac = 7 Dad = 5 Dbc = 3 Dbd = 9 Dcd = 8 * Can be calculated using different distance metrics
23
23 abcd a0875 b8039 c7308 d5980 a d c b Step 1:Choose the nodes with the shortest distance and fuse them. Constructing a tree starting from a STAR model
24
24 a Step 2: recalculate the distance between the rest of the remaining sequences (a and d) to the new node (e) and remove the fused nodesfrom the table. d c,b e a ade a056 d507 e670 D (ea) = (D(ac)+ D(ab)-D(cb))/2 D (ed) = (D(dc)+ D(db)-D(cb))/2 abcd a0875 b8039 c7308 d5980
25
25 !!!The distances Dce and Dde are calculated assuming constant rate evolution d c e a ade a056 d507 e670 b D ce D de Step 3: In order to get a tree, un-fuse c and b by calculating their distance to the new node (e)
26
26 a a,d c e ade a056 d507 e670 b D ce D de f Next… We want to fuse the next closest nodes
27
27 a c e fe f04 e40 b D af D de f d D ce D bf Finally D (ef) = (D(ea)+ D(ed)-D(ad))/2 We need to calculate the distance between e and f
28
28 a d c b acbd f e From a Star to a tree
29
29 IMPORTANT !!! Usually we don’t assume a constant mutation rate and in order to choose the nodes to fuse we have to calculate the relative distance of each node to all other nodes. Neighbor Joining (NJ)- is an algorithm which is suitable to cases when the rate of evolution varies
30
30 Human Evolution Tree Neighbor Joining UPGMA
31
The down side of phylogenetic trees - Using different regions from a same alignment may produce different trees.
32
Problems with phylogenetic trees
33
Bacillus E.coli Pseudomonas Salmonella Aeromonas Lechevaliera Burkholderias Problems with phylogenetic trees
34
What to do ?
35
35 A.We create new data sets by sampling N positions with replacement. B.We generate 100 - 1000 such pseudo-data sets. C.For each such data set we reconstruct a tree, using the same method. D.We note the agreement between the tree reconstructed from the pseudo-data set to the original tree. Note: we do not change the number of sequences ! Bootstrapping
36
Bootstrapped tree Less reliable Branch Highly reliable branch
37
37 Open Questions Do DNA and proteins from the same gene produce different trees ? Can different genes have different evolutionary history ?
38
38
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.