Presentation is loading. Please wait.

Presentation is loading. Please wait.

1 Introduction to Perl scripting Part 1 basic perl.

Similar presentations


Presentation on theme: "1 Introduction to Perl scripting Part 1 basic perl."— Presentation transcript:

1 1 Introduction to Perl scripting Part 1 basic perl

2 2 What is Perl? Scripting language Practical Extraction and Reporting Language Pathologically Eclectic Rubbish Lister 病态折中式电子列表器

3 3 How do I use Perl?  $ vi hello.pl print “hello world\n”;  $ perl hello.pl hello world  $ vi add.pl print $ARGV[0] + $ARGV[1], “\n”;  $ perl add.pl 17 25 42

4 4 Why Perl? FAST text processing Simple Scripting language Cross-platform Many extensions for Biological data

5 5 TMTOWTDI Motto: TMTOWTDI (There’s More Than One Way To Do It) This can be frustrating to new users Focus on understanding what you are doing, don’t worry about all the other ways yet.

6 6 Getting started Primitives – String - “string”, ‘string’ – Numeric - 10, 12e4, 1e-3, 120.0123 Data types – scalars - $var = “a”; $num = 10; – lists - @lst = (‘apple’, ‘orange’) – hashes - %hash=(1:’apple’, 2:’orange’)

7 7 Starter Code # assign a variable $var = 12; print “var is $var\n”; # concatenate strings $x = “Alice”; $y = $x. “ & Alex are cousins\n”; print $y; # print can print lists of variables print $y, “var is “, $var, “\n“;

8 8 Tidbits  To print to screen – print “string”  Special chars – newline - “\n” – tab “\t”  strings and numeric conversion automatic  All about context

9 9 Math  Standard arithmetic +, -, *, /  mod operator % - 4 % 2 = 0; 5 % 2 = 1  Operate on in place: $num += 3  Increment variable, $a++, $a--  power ** 2 5 = 2**5  sqrt(9)  log e (5) = log(5) - log 10 (100) = log(100) / log(10)

10 10 Precision Round down int ($x) Round up POSIX::ceil( $x ) Round down POSIX::floor( $x ) Formatted printing printf/sprintf – %d, %f, %5.2f, %g, %e – More coverage later one

11 11 Some Math Code # Pythagorean theorem my $a = 3; my $b = 4; my $c = sqrt($a**2 + $b**2); # what’s left over from the division my $x = 22; my $y = 6; my $div = int ( $x / $y ); my $mod = $x % $y; print $div, “ “, $mod, “\n”; output: 3 4

12 12 Logic & Equality  if / unless / elsif / else – if( TEST ) { DO SOMETHING } elsif( TEST ) { SOMETHING ELSE } else { DO SOMETHING ELSE IN CASE }  Equality: == (numbers) and eq (strings)  Less/Greater than:, >= – lt, le, gt, ge for string (lexical) comparisons

13 13 Testing equality $str1 = “mumbo”; $str2 = “jumbo”; if( $str1 eq $str2 ) { print “strings are equal\n”; } if( $str1 lt $str2 ) { print “less” } else { print “more\n”; if( $y >= $x ) { print “y is greater or equal\n”; }

14 14 Boolean Logic  AND – && and  OR – || or  NOT – ! not if( $a > 10 && $a <= 20) { }

15 15 Loops  while( TEST ) { } until( ! TEST ) { }  for( $i = 0 ; $i < 10; $i++ ) {}  foreach $item ( @list ) { }  for $item ( @list ) { }

16 16 Using logic for( $i = 0; $i < 20; $i++ ) { if( $i == 0 { print “$i is 0\n”; } elsif( $i / 2 == 0) { print “$i is even\n”; } else { print “$i is odd }

17 17 What is truth?  True – if( “zero” ) {} – if( 23 || -1 || ! 0) {} – $x = “0 or none”; if( $x )  False – if( 0 || undef || ‘’ || “0” ) { }

18 18 Special variables This is why many people dislike Perl Too many little silly things to remember perldoc perlvar for detailed info

19 19 Some special variables  $! - error messages here  $, - separator when doing print “@array”;  $/ - record delimiter (“\n” usually)  $a,$b - used in sorting  $_ - implicit variable  perldoc perlvar for more info

20 20 The Implicit variable  Implicit variable is $_  for ( @list ) { print $_ }  while( ) { print $_}

21 21 Input/Output: Getting and Writing Data

22 22 Getting Data from Files open(HANDLE, “filename”) || die $! $line1 = ; while(defined($line = )) { if( $line eq ‘line stuff’ ) { } } open(HANDLE, “filename”) || die $! while( ){ print “line is $_”; } open(HANDLE, “filename”) || die $! @slurp = ;

23 23 Data from Streams while( ) { print “stdin read: $_”; } open(GREP, “grep ‘>’ $filename”) || die $!; my $i = 0; while( ) { $i++; } close(GREP); print “$i sequences in file\n”;

24 24 Can pass data into a program while( ) { print “stdin read: $_”; } open(GREP, “grep ‘>’ $filename”) || die $!; my $i = 0; while( ) { $i++; } close(GREP); print “$i sequences in file\n”;

25 25 Writing out data open(OUT, “>outname”) || die $!; print OUT “sequence report\n”; close(OUT); # appending with >> open(OUT, “>>outname”) || die $!; print OUT “appended this\n”; close(OUT);

26 26 Filehandles as variables $var = \*STDIN open($fh, “>report.txt”) || die $!; print $fh “line 1\n”; open($fh2, “report”) || die $!; $fh = $fh2 while( ) { }

27 27 String manipulation

28 28 Some string functions. - concatenate strings – $together = $one. “ “. $two; reverse - reverse a string (or array) length - get length of a string uc - uppercase or lc - lowercase a string

29 29 split/join split: separate a string into a list based on a delimiter – @lst = split(“-”, “hello-there-mr-frog”); join: make string from list using delimiter – $str = join(“ “, @lst); – Solves fencepost problem nicely (want to put something between each pair of items in a list) print join(“\t”, @lst),”\n”;

30 30 index index(STRING, SUBSTRING, [STARTINGPOS]) Find the position of a substring within a string (left to right scanning) $codon = ‘ATG’; $str = AGCGCATCGCATGGCGATGCAGATG $first = index($str,$codon); $second = index($str, $codon, $first + length($codon)); rindex Same as index, but Right to Left scanning

31 31 substr substr(STRING, START,[LENGTH],[REPLACE]); Extract a substring from a larger string $orf = substr($str,10,40); $end = substr($str,40); # get end Replace string – substr($str,21,10,’NNNNNNNNNNN’);

32 32 Zero based economy... 1st number is ‘0’ for an index or 1st character in a string – most programming languages Biologists often number 1st base in a sequence as ‘1’ (GenBank, BioPerl) Interbase coordinates (Kent-UCSC, Chado-GMOD)

33 33 Coordinate systems Zero based, interbase coordinates A T G G G T A G A 0 1 2 3 4 5 6 7 8 9 1 based coordinates A T G G G T A G A 1 2 3 4 5 6 7 8 9

34 34 Arrays and Lists Lists are sets of items Can be mixed types of scalars (numbers, strings, floats) Perl uses lists extensively Variables are prefixed by @

35 35 List operations reverse - reverse list order $list[$n] - get the $n-th item – $two = $list[2]; scalar - get length of array – $len = scalar @list; – $last_index = $#list delete $list[10] - delete entry

36 36 Autovivication Automatically allocate space for an item $array[0] = ‘apple’; print scalar @array, “ ”; $array[4] = ‘elephant’; $array[25] = ‘zebra fish’; print scalar @array, “ ”; delete $array[25]; print scalar @array, “\n”; output: 1 26 5

37 37 pop,push,shift,unshift # remove last item $last = pop @list; # remove first item $first = shift @list; # add to end of list push @list, $last; # add to beginning of list unshift @list, $first;

38 38 splicing an array splice ARRAY,OFFSET,LENGTH,LIST splice ARRAY,OFFSET,LENGTH splice ARRAY,OFFSET splice ARRAY @list = (‘alice’,’chad’,’rod’); ($x,$y) = splice(@list,1,2); splice(@list, 1,0, (‘marvin’,’alex’)); newlist: (‘alice’,’marvin’,’alex’,’chad’,’rod’);

39 39 Sorting with sort @list = (‘tree’,’frog’, ‘log’); @sorted = sort @list; # reverse order @sorted = sort { $b cmp $a } @list; # sort based on numerics @list = (25,21,12,17,9,8); @sorted = sort { $a $b } @list; # reverse order of sort @revsorted = sort { $b $a } @list;

40 40 How would you sort based on part of string in list?

41 41 @list = (‘E1’,’F3’,‘A2’); @sorted = sort @list; # sort lexical @sorted = sort { substr($a,1,1) substr($b,1,1) } @list;

42 42 Filter with grep @list = (‘aardvark’, ‘baboon’, ‘cat’, ‘dog’,’lamb’,’kangaroo’); @sl = grep { length($_) == 3} @list; @oo = grep { index($_,”oo”) >= 0 } @list; # use it to count my $ct = grep { substr($_,1,1) eq ‘a’} @list;

43 43 Transforming with map @list = (‘aardvark’, ‘baboon’, ‘cat’, ‘dog’,’lamb’,’kangaroo’); @lens = map { length($_) } @list; @upper = map { $fch = substr($_,0,1); substr($_,0,1,uc($fch)) } @list

44 44 More list action @list = (‘aardvark’, ‘baboon’, ‘cat’, ‘dog’,’lamb’,’kangaroo’); for $animal ( @list ) { if( length($animal) <= 3 ) { print “$animal is noisy\n”; } else { print “$animal is quiet\n”; }

45 45 Sort complicated stuff # want to sort these by gene number @list = (‘CG1000.1’, ‘CG0789.1’, ‘CG0321.1’, ‘CG1227.2’); @sorted = sort { ($locus_a) = split(/\./,$a); ($locus_b) = split(/\./,$b); substr($locus_a,0,2,’’); substr($locus_b,0,2,’’); $locus_a cmp $locus_b; } @list; print “sorted are “,join(“,”,@sorted), “\n”;

46 46 Scope The section of program a variable is valid for Defined by braces { } use strict; Use ‘my’ to declare variables

47 #!/usr/bin/perl -w use strict; my $var = 10; my $var2 = ‘monkey’; print “(outside) var is $var\n”. “(outside) var2 is $var2\n”; { my $var; $var = 20; print “(inside) var is $var\n”; $var2 = ‘ape’; } print “(outside) var is $var\n”. “(outside) var2 is $var2\n”;

48 48 Good practices Declare variables with ‘my’ Always ‘use strict’ ‘use warnings’ to get warnings

49 49 Let’s practice (old code) @list = (‘aardvark’, ‘baboon’, ‘cat’, ‘dog’,’lamb’,’kangaroo’); for $animal ( @list ) { if( length($animal) <= 3 ) { print “$animal is noisy\n”; } else { print “$animal is quiet\n”; }

50 50 Let’s practice #!/usr/bin/perl use warnings use strict; my @list = (‘aardvark’, ‘baboon’, ‘cat’, ‘dog’,’lamb’,’kangaroo’); for my $animal ( @list ) { if( length($animal) <= 3 ) { print “$animal is noisy\n”; } else { print “$animal is quiet\n”; }

51 51 Editors vi filename – begin by using this editor

52 52 Make a perl script $ pico hello.pl #!/usr/bin/perl print “hello world\n”; [Control-O, enter, Control-X enter] $ perl hello.pl hello world $ chmod +x hello.pl $./hello.pl

53 53 Environment variables Variables that are set in the shell Try typing env at the command-line You can update the variables by typing – export VARIABLE=VALUE – export PATH=$PATH:/usr/local/bio/bin – You can make this more permanent by adding the line to your.bashrc file

54 54 Perl Just like UNIX looks for programs in a set of directories (defined by PATH variable) Perl will look for modules in a set of directories PERL5LIB variable lets you add to that set of dirs


Download ppt "1 Introduction to Perl scripting Part 1 basic perl."

Similar presentations


Ads by Google