1. AIDS Defining and AIDS Associated Malignancies

2. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach to the practice of medicine without falling asleep

3. What are the AIDS Defining Malignancies? AIDS Associated Malignancies?

4. AIDS Defining Malignancies Kaposi’s sarcoma Non Hodgkin’s lymphoma Squamous cell carcinoma of the cervix/anus* * AIDS associated malignancy

5. Variations on a Theme Oncogenic viral infection –KS –Lymphoma –SCCa cervix/anus Proliferation of a benign cell -KS -Lymphoma -SCCa cervix/anus Immune dysregulation -Up regulation -Down regulation -Direct role of HIV

6. Variations on a Theme Oncogenic viral infection –KS = KSHV –Lymphoma = EBV and KSHV –SCCa cervix/anus = HPV Proliferation of a benign cell -KS = lymphatic endothelial cell -Lymphoma = B lymphocyte -SCCa cervix/anus = squamous epithelium Immune dysregulation -Increased production of inflammatory cytokines -Loss of cell mediated immunity to control viral infections -Any direct role of HIV: Tat up regulation of virus gene expression

7. How do viruses cause cancer? What about cytokines How does being CD4 T lymphopenic make you susceptible to cancer?

8. Case 1 A 28 year old man with early stage HIV presented anxious and upset over the development of disfiguring skin lesions.

9. Kaposi’s Sarcoma can range from disfiguring to …..

10. organ and limb threatening …

11. Kaposi’s Sarcoma

12. Don’t treat without meat…... This is bacillary angiomatosis, an infection due to Bartonella sp. It is treated with erythromycin

13. Kaposi’s Sarcoma Was among the initial features of AIDS Three epidemiologic subsets –Endemic - seen in sub Saharan Africa –Epidemic - associated with HIV infection –Sporadic - aging men of Mediterranean descent Strong relationship with immune deficiency –Transplant patients –Recipients of immunosuppressive agents –Aged individuals Long thought to have an infectious etiology –HHV-8 or KSHV was discovered in 1994 by Moore and Chang

14. Kaposi Sarcoma Herpes Virus Human Herpes Virus - 8 How prevalent is KSHV in the US population? How prevalent is KSHV in HIV infected persons? What is the primary route of transmission of KSHV Does everyone with KSHV infection get KS?

15. Kaposi Sarcoma Herpes Virus Human Herpes Virus - 8 Prevalence of KSHV infection is 5% in USA. Prevalence of KSHV infections is 26% to 40% in HIV infected persons. Shed in the SALIVA, the primary route of transmission KS develops in a minority of immune competent persons, but 50% of HIV infected persons. Present in ALL KS lesions from ALL types of KS

16. Two types of KSHV (HHV-8) Infection Latent seen in Kaposi’s sarcoma –No virus replication –Limited expression of virus genes Lytic seen primary effusion lymphoma –Production of virus progeny –Expression of many viral genes

17. Many of the KSHV genes operate to create the perfect environment for malignancy Inhibition of cell cycle regulation Prevent apoptosis Modulate the immune system Promote angiogenesis Latent infection can be converted to lytic infection under conditions of hypoxia.

18. Pathogenesis KSHV has tropism for lymphatic endothelial cells, B cells, macrophages, and epithelial cells. In KS latent infection is more prevalent than lytic. Latent state KSHV genes codes for proteins that support KS oncogenesis –LANA-1 inhibits p53 –vCyclin (homolog of cyclin D2) that is resistant to CDK inhibitors –vFLIP (homolog of FLIP) that inhibits apoptosis

19. Role of cytokines in pathogenesis Cytokines –From HIV-infected macrophages and activated T cells –IL-1, IL-2, PF4, IFN- , TNF-  –Cause proliferation of lymphatic endothelial cells –Permissive environment for KSHV infection

20. Treatment First Line: protease inhibitor containing regimen –20% to 60% of patients may respond with HAART alone. –Best responses: drug naïve, skin only, and CD4 increase >150 –CR is not necessarily protective against recurrence. Advanced KS in late stage AIDS often requires more Rx –Enhanced immunity against KSHV is not enough –VEGF inhibitors, liposomal adriamycin, conventional cytotoxic Rx Goal of treatment is palliation

21. Where has all the KS gone? There has been a dramatic decline in incidence with HAART - Adjusted incidence pre HAART: 15.2/1000 person years - Adjusted incidence post HAART: 4.9/1000 person years Immune reconstitution and better control of KSHV Anti angiogenesis effects of protease inhibitors

23. AIDS associated Lymphomas

24. Peripheral lymphomasPeripheral lymphomas ? ?

25. AIDS associated Lymphomas Peripheral lymphomasPeripheral lymphomas Primary effusion lymphomasPrimary effusion lymphomas Primary CNS Primary CNS

26. Epidemiology Rates may be under estimated 2° to hierarchy of reporting. Incidence in AIDS is estimated from 4 to 16%. Risk of NHL in HIV is 100-200X risk of HIV neg. –80% of HIV lymphomas are high grade, 15% are low grade. –Just the opposite for HIV negative persons

27. What viruses contribute to lymphomagenesis? EBV KSHV HIV

28. Lymphomagenesis: virus HIV - not directly involved in malignant transformation. EBV - causes polyclonal B cell proliferation leading to genetic instability increasing the chance of a transforming mutation, such as myc translocation. –Implicated in CNS and Primary Effusion Lymphomas KSHV - how could this virus possibly cause lymphoma? –Implicated in primary effusion lymphoma and multicentric Castleman’s disease

29. Lymphomagenesis Cytokines –IL-6 and IL-10 Loss of immune surveillance –Loss of CD4 clones that control EBV infected B cells –Loss of CD8 function (due to loss of CD4 help) –Permits proliferation of EBV infected B lymphoblasts –EBV infected lymphs can evade immune detection

30. Prognosis Most prognostic data comes from pre-HAART era –CD4< 200 median survival = 4 months –CD4 >200 median survival = 11 to 18 months Overall median survival in HAART era 24 months NCI AIDS Malignancy Branch peripheral lymphoma patients receiving EPOCH ± R - at 53 months follow up overall survival is 60%. Median survival for PEL 3 to 6 months. Median survival for primary CNS lymphoma –Radiation alone - 4 months –Chemotherapy 10 to 18 months

31. Antiviral therapy and Epidemiology Modern antiretroviral therapy does not prevent lymphoma, but rather maintains CD4 counts at levels that prevents development of the poor prognosis lymphomas (immunoblastic and primary CNS lymphoma).

32. Case 2 A 37 year old man with long standing HIV infection presents with mid epigastric pain, hemoccult positive stools, and a microcytic hypochromic anemia. Upper endoscopy revealed:

33. Peripheral Lymphoma Histology Burkitt’s and Burkitt’s-like –Occurs in state of relative immune preservation –Bone marrow and nodal sites predominate –EBV is absent esp in sporadic Burkitt's Diffuse Large B cell Lymphoma; centroblastic –Occurs in state of relative immune preservation –GI and CNS sites predominate –Good prognosis Diffuse Large B cell Lymphoma; immunoblastic –Occurs in later stage HIV infection –GI and CNS sites predominate –Poor prognosis

34. Peripheral Lymphomas Extranodal involvement is common. –CNS (leptomeninges) - 20 to 40% at presentation –GI - 30% at presentation –Orbit, skin, salivary glands, heart, lung, muscle, bones, adrenals, rectum, gonads, placenta Stage –Most present with stage III, IV or IE bulky disease

35. Treatment Induction of remission requires chemotherapy. All patients receive CNS prophylaxis Controversial Issues –Dose intensity and regimen –Infusional (EPOCH) vs. bolus (CHOP) therapy –Concurrent use of HAART WHY? –Use of rituximab WHY?

36. Case 3 A 39 year old man, known to be HIV positive presents with new onset ascites. Further examination and evaluation reveal bilateral pleural effusions and pericardial effusion. A pericardiocentesis reveals:

37. Primary Effusion Lymphoma Usually occurs in young, homosexual men with advanced HIV Epidemiology similar to that of KS Disease usually restricted to pericardium, pleura, peritoneal cavity without contiguous tumor mass. Poor outcome (survival <5 mos). Tumor cell is B cell lineage: –Kappa and lambda light chain mRNA –Ig heavy chain with k light chain mRNA KSHV –Uniformly express KSHV; frequently EBV

38. PEL Treatment Refractory to conventional chemotherapy Some short remissions with EPOCH Experimental therapies exploit KSHV pathophysiology –KSHV codes for several kinases –These kinases phosphorylate (activate) AZT and ganciclovir –Theoretically, the drugs will be activated primarily in KSHV infected B cells, killing primarily those cells.

39. Guanosine Ganciclovir AZT Thymidine

40. AZT and GCV are phosphorylated and then incorporated into a growing chain of DNA. What do you think happens next?

41. AZT ACTGACTGACTGACTGACTACTGACTGACTGACTGACT TGACTGACTGACTGACTGATGACTGACTGACTGACTGA GCV AZT GCV cKINASE B lymphoctye from person treated with AZT, GCV

42. AZT ACTGACTGACTGACTGACTACTGACTGACTGACTGACT TGACTGACTGACTGACTGATGACTGACTGACTGACTGA GCV AZT GCV cKINASE - (PO 4 ) 3 Kinases triphosphorylate both AZT, GCV

43. AZT ACTGACTGACTGACTGACTACTGACTGACTGACTGACT TGACTGACTGACTGACTGATGACTGACTGACTGACTGA GCV AZT GCV cKINASE - (PO 4 ) 3 v KINASE KSHV KSHV infected B cell has additional kinase activity

44. AZT ACTGACTGACTGACTGACTACTGACTGACTGACTGACT TGACTGACTGACTGACTGATGACTGACTGACTGACTGA GCV AZT GCV KINASE - (PO 4 ) 3 v KINASE KSHV - (PO 4 ) 3 What do you think happens to this cell?

45. ACTGACTGACTGACTGACTACTGACTGACTGACTGACT ACTGACTGACTGACTGACTACTGACTGACTGACTGACT Theoretically, there is more cell kill in the KSHV infected B cells because there is more phosphorylation of the drugs. Yes this therapy is toxic, but it targets virus infected cells.

46. Case 4 A 45 year old man with long standing HIV infection presents with focal neurologic deficits. Imaging reveals:

47. Primary CNS Occurs in setting of severe immune suppression 20X decrease incidence with modern antivirals Multifocal (few large 3 to 5 cm lesions), developing at perivascular cuffs Primarily immunoblastic histology Monoclonal B cell population, EBV+ ALWAYS PET +, thallium +, EBV PCR of CSF for dx vs. brain bx –Nuc med scan + and PCR + has neg predictive value of 100%

48. Primary CNS Treatment Optimize antiretrovirals to restore or enhance EBV immunity. Radiation, 4000cGy, is standard approach Considerable morbidity associated with WB XRT Rubinstein (ASCO 2006): high dose methotrexate with leucovorin rescue, temozolomide, and rituximab for induction, then high dose ARA-C with etoposide infusion for consolidation. –52% complete remission rate –Median progression free survival is 11.5 months –Median overall survival has not been reached with 27.5 months follow up. Median survival pre HAART 4 months; HAART era 15 mos.

50. Case 5 48 year old man presents for follow up of rectal bleeding, a sensation of rectal fullness, and some pain with defecation. On exam he is found to have a numerous anal condylomata and a firm 4cm mass just inside the anal verge which is tender to palpation and slightly ulcerated.

51. Squamous Cell Carcinoma notSCCa of the anus is not AIDS defining, but is an AAM –Relative risk is 6.8 in women, 37.9 in men –About 130 to 160 fold increase over HIV- population isSCCa of the cervix is and AIDS defining illness. –Incidence still rising as of 1998 –RR is 3.2 in HIV infected women –20% of infected women without cervical disease developed SIL within 3 yrs. (versus 5% of HIV neg women)

52. Role of HPV HIV + persons are 2-6X more likely to have HPV infection than HIV- persons. HIV + persons are 7X more likely to have persistent HPV infections compared to HIV-. HPV infection is poorly controlled in HIV+ –Cell mediated immune defects –Humoral defects HPV16 or 18 is detected in most anal carcinomas HPV 16 is detected in nearly 50% of cervical cancers.

53. E1 E2E3E4 E5 E6 E7 HPV Genome and Development of Malignancy EARLY GENES episomalHPV episomal (circular): E2 controls E6 and E7 gene transcription. When episomal, HPV does no harm. By poorly understood mechanisms, HPV can become linear and integrate into our DNA. The E2 gene is disrupted in this process.

54. E1 E 2 E3E4 E5 E6 E7 HPV Genome and Development of Malignancy EARLY GENES integrates:HPV integrates: E2 control is lost and E6 & E7 are over expressed. bind and inactivateE6 and E7 gene products bind and inactivate p53 and RB p53 and RB are tumor suppressor genes. Tat up regulates E6 and E7 transcription further inhibiting tumor suppression. Loss of transcriptional control of E6 and E7 genes binds p53; loss of suppressor function binds RB, inactivating RB gene product

55. Clinical Features of Anal Carcinoma Most common location for anal cancer is at transformation zone approximately 2 cm from the anal verge. Rectal bleeding is the most common sign 30% have pain or sensation of a mass Often asymptomatic

56. Clinical Features of Cervical Cancer Presentation is usually at the junction of the primary columnar epithelium of the endocervix and the squamous epithelium of the ectocervix. Abnormal bleeding is most common sign High grade intraepithelial lesions may not bleed. Early disease is usually painless.

57. Treatment High grade squamous cell intraepithelial neoplasia –85% trichloroacetic acid –Liquid N2 –Imiquimod (an immune response modifier) –Topical 5-FU –Podophyllotoxin –Surgical resection of the transformation zone do not eradicate the HPV infectionThese therapies do not eradicate the HPV infection and recurrence of neoplasm is is common. –Preventive vaccines prevent HPV-16 infx in HIV neg women. –No evidence to suggest a therapeutic vaccine would work.

58. Treatment Invasive DiseaseInvasive Disease –HIV infected persons should be offered same therapy used in HIV negative persons. –Antiretroviral medications should be continued. –Responses are comparable to HIV- patients, but toxicity is much higher. –Large prospective trials are sorely missing.

59. AAM - a unique opportunity Restore immune response to oncogenic viruses with combination antiviral therapy Control cytokine dysregulation by controlling HIV infection with combination antiretroviral therapy Specific therapy for oncogenic viruses –Therapeutic vaccination –Targeted therapies, i.e. directed at virus gene products, i.e. bevacizumab –Take advantage of viral proteins, i.e, KSHV, AZT, GCV

60. And the winner of January Mustache…….

61. Case 5 32 yo year old HIV infected man presents with several day history of fevers, chills, orthostatic symptoms, extreme fatigue, anorexia, and dyspnea at rest. T = 102 BP 90/40 P=120 RR 34/min O2 sat 92% Acutely ill appearing man Diffuse lymphadenopathy, course rhonchi bilaterally, decreased bowel sounds, mild diffuse abdominal tenderness, scattered KS lesions on legs Labs: WBC 2.5, Hgb 7.6, Plt 43,000 Na 122, albumin 2.8, CRP 9.43, LDH 254 (nl).

62. Castleman’s Disease Unicentric Castleman’s DiseaseUnicentric Castleman’s Disease –Described by Benjamin Castleman in 1956. –Isolated benign lymphoproliferative disorder of young adults –Pathology is usually hyalin vascular type. (20% are plasma cell variant) –M=F, median age 35 yrs –Large asymptomatic mediastinal or hilar nodes –Cured with resection, radiation, rituximab –May be associated with increased risk for B cell lymphoma

63. Castleman’s Disease Described in 1978 Male predominance, median age 52, younger if HIV infected Present with waxing and waning symptoms over variable period of time; may be difficult to dx if not considered. Symptoms: chills, wt loss, anorexia, fatigue, cough, abdominal pain Signs: Fever, generalized lymphadenopathy, hepatomegaly, splenomegaly In HIV+ patients, 100% are associated with HHV-8 –Co-exists with Kaposi’s sarcoma –Pathology: preserved architecture, proliferation of follicles, blood vessels and plasma cells in the interfollicular areas, increased immunoblasts.

64. Plasma cell variant Castleman’s disease

65. Hyaline variant

66. Pathogenesis HHV-8 infection of B lymphocytes (mantle zone lymphs) Lytic infection (latent infx in KS) HHV-8 codes for vIL-6 which in turn stimulates VEGF production. VEGF production stimulates human IL-6 from endothelial cells IL-6 is responsible for the constitutional symptoms and generalized adenopathy Most of the symptoms are thought related to IL-6 and is a novel therapeutic target.

67. Treatment Combination chemotherapy –Etoposide, vincristine, cladribine, chlorambucil, prednisone –EPOCH-R and CHOP Rituximab alone High dose AZT and ganciclovir Interferon alpha (low dose escalating x 6 to 12 mos) Anti – IL-6 receptor –Tocilizumab and atilzumab Cidofovir

68. … life threatening disease

69. Immune Reconstitution KS Before HAART After 2 months of HAART

71. Treatment When considering treatment other than HAART: –Treat life threatening disease –Treat limb or organ threatening disease –Cosmetically significant lesions Complete remission does not protect against later recurrence.