Presentation is loading. Please wait.

Presentation is loading. Please wait.

Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal.

Published byJayson Jordan Modified over 8 years ago

Similar presentations

Presentation on theme: "Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal."— Presentation transcript:

1 Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal name: Transgenic Research Authors: Vibha G. Checker, Anju K. Chhibbar and Paramjit Khurana Corresponding Authors: Paramjit Khurana Department of Plant Molecular Biology, University of Delhi South Campus, Dhaula Kuan, New Delhi-110021, India. Supplementary data 2 Table 1 and Fig. S1 to S7

2 Line Abbreviation Average Leaf Area (cm 2 ) Internodal Length (cm) Control (NT)NT44.3 ± 07.513.2 ± 0.2 actin1:Hva1ST37.0 ± 05.192.3 ± 0.6 rd29A:Hva1VR153.3 ± 04.002.7 ± 1.2 rd29A:Hva1VR6.256.1 ± 01.802.6 ± 0.5 rd29A:Hva1VR7.151.6 ± 10.002.7 ± 0.3 rd29A:Hva1VR8.152.3 ± 04.722.6 ± 0.4 rd29A:Hva1VR9.160.3 ± 16.202.4 ± 0.0 rd29A:Hva1VR11.396.4 ± 05.802.4 ± 0.2 Supplementary data 2 Table 1: Morphological features of transgenic and non-transgenic lines

3 a b c DROUGHT STRESSSALT STRESS a b c Supplementary data 2, Fig. S1 Physiological characterization of actin1:Hva1 transgenic lines under drought (2% PEG) and salinity stress (400 mM NaCl). Proline content (a), Membrane injury (b), and Photosynthetic yield (Fv/Fm) (c) were measured at indicated time points. (K2 = Non- transgenic line, ST = actin1:Hva1 transgenic lines) Values are significant at P ≤ 0.05

4 (b)(b) (c)(c) ( d ) (g) (f)(f) (e)(e) (h)(h) NT ST VR9.1 (a)(a) Right border (25bp) BamHI Sac I pBI121:rd29a:Hva1 Nos-pro (302 bp) NPT II (795bp) Nos-ter (253 bp) rd29A-Pro (686bp) Hva 1 (642bp) Nos-ter (253 bp) Left Border (26 bp) HindIIII (g)(g) Supplementary data 2, Fig. S2 Transformation and regeneration of mulberry (Morus indica) cv. K-2 via Agrobacterium tumefaciens (pBI121:rd29A:Hva1). (a) Vector map of pBI121:rd29a:Hva1. (b) Non-transformed hypocotyl, cotyledon and calli respectively. (c) Transformed explants after transfer to selection medium. (d) Regenerating explants on shoot elongation medium. (e) Shoot explants on root inducing medium. (f) Regenerants established in earthen pots. (g) Morphology of some transgenic plants. (h) Appearance of non-transgenic (NT), ST (actin1:Hva1) and VR9.1 (rd29A:Hva1) plants

5 Ladder Hva 1 Positive 1000 bp 500 bp 250 bp a Transgenic plants Negative VR1 VR2 VR4.2 VR5.5 VR6.2 VR7.1 VR8.1VR9.1 VR11.3 VR12.1 VR11.3 Ladder Transgenic plants npt II 1000 bp 500 bp b VR1 VR4 VR5.5VR6.2 VR7.1 VR8.1 VR9.1 Positive Negative Supplementary data 2, Fig. S3 PCR analysis of genomic DNA samples of putative transgenic plants of M. indica cv. K2 using specific primers of Hva1 (a) and nptII (b)

6 VR 11.3 VR 9.1 VR1 VR2 VR 6.2 VR 5.3 NT Digested 23.4kb 6.0 4.0 1.5 Hva 1 500bp NT Undigested Supplementary data 2, Fig. S4 Molecular confirmation of rd29A:Hva1 overexpressing transgenic mulberry plants (VR) and non-transgenic control plants (NT). Southern hybridization of genomic DNA samples of transgenic plants of mulberry was carried out with Hva1 gene as probe. Lane 1 and 2: NT (Non-transgenic/negative control), lane 3 to 8: BamHI and SacI digested samples of genomic DNA of transformed plantlets

7 ab cd Supplementary data 2, Fig. S5 Comparison of non-transgenic (NT), actin1:Hva1 (ST) and rd29A:Hva1 (VR) transgenic mulberry plants under control conditions. Proline content (a), percent membrane injury (b), photosynthetic yield (Fv/Fm) (c), and relative water content (RWC) (d) were measured to evaluate metabolic status of plants. Leaf tissues harvested on 0 day of the experiment were used for various analyses. Results are average of three experiments and three independent plants were taken for each experiment. Error bars represent standard deviation. Values are significant at P ≤ 0.05

8 STNT VR1 VR6.2 VR7.1VR8.1 VR9.1VR11.3 NT VR1 VR9.1 VR11.3 ST Supplementary data 2, Fig. S6 Western blot analysis to confirm expression of barley HVA1 in transgenic mulberry plants leaf proteins under field conditions Supplementary data 2, Fig. S7 In situ detection of reactive oxygen species (ROS) by nitroblue tetrazolium (NBT) staining of non-transgenic (NT), actin1:Hva1 (ST) and rd29A:Hva1 (VR) transgenic mulberry leaves. Blue color indicates the characteristic staining pattern of ROS

Download ppt "Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal."

Similar presentations

Supplementary table 1: Primers used for PCR amplification Primer nameSequence 5`-3`Accession Number ChiFACCAAGCTACTCGCAAGAGGCD485880 ChiRCGGAAGCGCAGTAAGATGA.

Supplementary table 1: Primers used for PCR amplification Primer nameSequence 5`-3`Accession Number ChiFACCAAGCTACTCGCAAGAGGCD ChiRCGGAAGCGCAGTAAGATGA.
Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.

Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.
Lecture 18, Chapter 11 Analysis of transgenic plants part I Mat Halter 3/27/12 Plant Genetics, Breeding and Biotechnology (PLSC 452/552), University of.

Lecture 18, Chapter 11 Analysis of transgenic plants part I Mat Halter 3/27/12 Plant Genetics, Breeding and Biotechnology (PLSC 452/552), University of.
Lecture 19, Chapter 11 Analysis of transgenic plants part II Neal Stewart.

Lecture 19, Chapter 11 Analysis of transgenic plants part II Neal Stewart.
Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.

Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.
Workpackage 2: Breeding Systems Specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

Workpackage 2: Breeding Systems Specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.
Figure S1. Genomic PCR of in vitro potato plants transformed with StPTB1 prom (top) and StPTB6 prom (bottom) constructs using nptII-specific primers. Thirty.

Figure S1. Genomic PCR of in vitro potato plants transformed with StPTB1 prom (top) and StPTB6 prom (bottom) constructs using nptII-specific primers. Thirty.
By by Enkhchimeg Vanjildorj Supervisor Prof. Lee, Hyo-Yeon College of Applied Life Sciences, Cheju National University, Jeju 690- 756, Korea College of.

By by Enkhchimeg Vanjildorj Supervisor Prof. Lee, Hyo-Yeon College of Applied Life Sciences, Cheju National University, Jeju , Korea College of.
(a) (b) (c) (d) (e) (f) (g) Figure S1.. Figure S1. Comparison of OsPCR1-6 and GW2 transcript levels in the grains of developing gw2 and wild-type isogenic.

(a) (b) (c) (d) (e) (f) (g) Figure S1.. Figure S1. Comparison of OsPCR1-6 and GW2 transcript levels in the grains of developing gw2 and wild-type isogenic.
Differential Accumulation Pattern of Met-rich  -zein in Medicago sativa and Medicago truncatula Serina Padilla Dr. Champa Sengupta-Gopalan, Mentor Department.

Differential Accumulation Pattern of Met-rich  -zein in Medicago sativa and Medicago truncatula Serina Padilla Dr. Champa Sengupta-Gopalan, Mentor Department.
Supplemental Figure 1. The wxr3 mutant exhibits decreased expression of CYCB1;1, SCR and SHR compared with the control. A and B, Expression of ProCYCB1;1:GUS.

Supplemental Figure 1. The wxr3 mutant exhibits decreased expression of CYCB1;1, SCR and SHR compared with the control. A and B, Expression of ProCYCB1;1:GUS.
Soybean Transformation and Regeneration Using “Half-Seed” Explants Margie M. Paz and Kan Wang Department of Agronomy, Iowa State University, Ames, IA 50011-1010,

Soybean Transformation and Regeneration Using “Half-Seed” Explants Margie M. Paz and Kan Wang Department of Agronomy, Iowa State University, Ames, IA ,
Lim et al, Supplemental Figure S1. OsRING-H2 type : 5 OsRING-HC type : 1 OsRING-v type : 1 OsRING-H2 type : 9 OsRING-HC type : 8 OsRING-v type : 2 OsRING-H2.

Lim et al, Supplemental Figure S1. OsRING-H2 type : 5 OsRING-HC type : 1 OsRING-v type : 1 OsRING-H2 type : 9 OsRING-HC type : 8 OsRING-v type : 2 OsRING-H2.
Group 4 Data Diane Meas The 3 A-Michaels (get it??) 3 amigos… a-michaels….

Group 4 Data Diane Meas The 3 A-Michaels (get it??) 3 amigos… a-michaels….
Supplementary Fig. S1 Determination of T-DNA copy number by Southern blot analysis. Fifteen µg genomic DNA of Bintje and mutant nikku were digested with.

Supplementary Fig. S1 Determination of T-DNA copy number by Southern blot analysis. Fifteen µg genomic DNA of Bintje and mutant nikku were digested with.
LOGO A novel WRKY transcriptional factor from Thlaspi caerulescens negatively regulates the osmotic stress tolerance of transgenic tobacco Plant Cell Rep.

LOGO A novel WRKY transcriptional factor from Thlaspi caerulescens negatively regulates the osmotic stress tolerance of transgenic tobacco Plant Cell Rep.
Fig. S1. Amino acid sequence alignment of MYBS3 proteins. MYBS3 protein sequences of Arabidopsis thaliana (MYBH; NP_199550); (At3g16350; NP_188256), Glycine.

Fig. S1. Amino acid sequence alignment of MYBS3 proteins. MYBS3 protein sequences of Arabidopsis thaliana (MYBH; NP_199550); (At3g16350; NP_188256), Glycine.
Workpackage 2: Breeding Systems specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

Workpackage 2: Breeding Systems specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.
A) EF175930 ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM208590.1 ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.
Workpackage 2: Breeding Systems

Workpackage 2: Breeding Systems

Similar presentations

Ads by Google